DIN Vol. 1 TABLE OF CONTENTS
DIN Vol. 2 TABLE OF CONTENTS
DIN Vol. 3 TABLE OF CONTENTS
DIN Vol. 4 TABLE OF CONTENTS
DIN Vol. 5 TABLE OF CONTENTS
DIN Vol. 6 TABLE OF CONTENTS
DIN Vol. 7 TABLE OF CONTENTS
DIN Vol. 8 TABLE OF CONTENTS
DIN Vol. 9 TABLE OF CONTENTS
DIN Vol. 10 TABLE OF CONTENTS
DIN Vol. 11 TABLE OF CONTENTS
DIN Vol. 12 TABLE OF CONTENTS
DIN Vol. 13 TABLE OF CONTENTS
DIN Vol. 14 TABLE OF CONTENTS
DIN Vol. 15 TABLE OF CONTENTS
DIN Vol. 16 TABLE OF CONTENTS
DIN Vol. 17 TABLE OF CONTENTS
DIN Vol. 18 TABLE OF CONTENTS
DIN Vol. 19 TABLE OF CONTENTS
DIN Vol. 20 TABLE OF CONTENTS
ISSUES OF DROSOPHILA INFORMATION NEWSLETTER
DROSOPHILA INFORMATION NEWSLETTER
Volume 1, January 1991
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS (see below). Materials appearing in the
Newsletter will be reprinted, in unedited form, in the next issue
of DIS. Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. We have made obvious substitutions in
most cases (e.g. u for micro, B for beta). Both superscripts and
subscripts have been enclosed in square brackets; the difference
should be obvious by context. Bold face, italics, underlining,
etc. cannot be retained. Please keep this in mind when preparing
submissions.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
many of your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Univ. of Utah Medical Center Indiana University
Salt Lake City, UT 84132 Bloomington, IN 47405
801-581-2937; FAX/5374 812-855-5782; FAX/2577
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@IUBACS.BITNET
MATTHEWK@UCS.INDIANA.EDU
*** DIN 1
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail. If
you are on the list and do not wish to receive DIS, or you want
to remove a defunct address, replace SUB in the above message
with UNS. The SUB command can also be used to correct spelling
errors in your real name; the new entry will simply replace the
old as long as it was sent from the same USERID@NODE address.
*** DIN 1
DIN Vol. 1 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>DIS Vol. 70 - Traditional DIS
>32nd Drosophila Research Conference
>Corrections to Ashburner Drosophila Handbook and Manual
>REQUESTS FOR MATERIALS
>Clones needed for Drosophila genome project
>DATABASES/COMPUTING
>Integrated Drosophila Database
>Drosophila genetic maps
>Drosophila GENMAP database
>IUBIO//Stock center stock lists
>GENETIC NOTES
>Conventions for the naming of genes and their alleles
>TECHNICAL NOTES
>Drosophila codon tables
>A single base error in the pCaSpeR-Bgal polylinker
>P element-mediated transformation of D. melanogaster using
purified P element transposase
>Targeted tissue-specific expression of genes in Drosophila
- A P element expression system that uses the Gal4
activator
>Whole mount in situ hybridization to imaginal discs using
digoxygenin labeled DNA probes
>Antibody staining of imaginal discs
>Single-fly DNA preps for PCR; Inverse PCR
>Topical insecticide test method for Drosophila
>EQUIPMENT
>Population bottle update
*** DIN 1
ANNOUNCEMENTS
DROSOPHILA INFORMATION SERVICE Vol. 70
James Thompson, Dept. of Zoology, Univ. of Oklahoma, Norman, OK
73019. 405-325-4821; FAX/7560.
Drosophila Information Service has a long and respected
history of promoting communication among geneticists, ecologists,
systematists, and molecular biologists who focus upon this
species in their research. DIS is a non-profit service to
biologists world-wide. As you know, Philip Hedrick has stepped
down after many years as editor of DIS. I hope you will join me
in thanking him for his efforts. In the interests of maintaining
this useful organ of communication for the Drosophila community,
I have volunteered to become the next editor of DIS. The format
of DIS will remain very similar to those in the past, but some
areas will be added or expanded. * Research notes and new mutant
sections will continue. * Coverage of techniques will be expanded
to include more molecular and cellular techniques. * A group of
assistant editors will be invited to help solicit material and
develop new areas of coverage. * International representatives
will be included to help draw attention to Drosophila activities
world-wide. * Information will be provided on accessing and using
new sources of information, such as the Drosophila Information
Newsletter and computerized stock and clone lists. * Information
on Drosophila Research conferences in the U.S. and abroad will be
included to help promote better communication among all
Drosophila workers. DIS 70 may be ordered by sending a check for
$8.00 (U.S. dollars drawn on a U.S. bank, payable to "Drosophila
Information Service") per copy to the above address by 1 April
1991.
*** DIN 1
32ND DROSOPHILA RESEARCH CONFERENCE
The 1991 Drosophila Research Conference will be held March
20-24 at the Chicago Hilton and Towers, Chicago, Illinois, USA.
The Drosophila group at Indiana University, Bloomington, IN is
responsible for the program. Deadline for advance registration is
January 31, 1991. For further information, contact: Anne Marie
Langevin, Meetings Manager, Genetics Society of America, 9650
Rockville Pike, Bethesda, MD 20814; 301-571-1825.
*** DIN 1
REQUESTS FOR MATERIALS
REQUEST FOR CLONES
Leonard Rabinow[1] and Robert Saunders[2]. 1- Waksman Institute,
Rutgers Univ., Piscataway, NJ 08855-0759, USA. 908-932-0091/0092,
FAX/5735, RABINOW@BIOVAX. 2- Dept. of Biochemistry, Univ. of
Dundee, Dundee DD1 4HN, UK. (0382)23181 ext. 4790, FAX/201063,
BI31@UK.AC.DUNDEE.PRIMEB [reverse node order from US].
Most readers of DIS are probably aware of a number of
projects in progress with the aim of constructing a physical map
of the Drosophila melanogaster genome. A collaboration among the
laboratories of F.C. Kafatos, C. Louis, D.M. Glover, and M.
Ashburner is proceeding by fingerprinting cosmids selected with
cytological division-specific probes produced by microdissection
from polytene chromosomes (Nucl. Acids Res. (1990) 18, 6261-
6270). J. Messing, L. Rabinow, W. Sofer and G. Hamm at the
Waksman Institute, are initiating a project to produce a
restriction map of the genome, using bacteriophage P1 and
automated reading of partial restriction digests.
Both projects will correlate their developing physical maps
with the genetic and cytological maps of Drosophila. To achieve
this, we would like to probe our libraries with loci cloned and
mapped by members of the Drosophila community. We would greatly
appreciate it if members of the fly community willing to
contribute clones would send them to either of the above
addresses. It would be most convenient if clones could be sent in
plasmids (preferably bearing T7, SP6 or T3 RNA polymerase
promoters), or M13, to avoid cross-hybridization problems. A few
micrograms of a specific oligonucleotide, if available, could
also be used. Submissions would be most useful if accompanied by
information on the name, identity, and location of the clone, its
vector, a restriction map or sequence, and a reference. To
coordinate the overall efforts, clones and data will be exchanged
among these groups. Submitted clones will be exchanged only
between these two groups, unless specifically authorized by the
sender.
*** DIN 1
Michael Ashburner, Department of Genetics, Univ. of Cambridge,
Cambridge CB2 3EJ, England. 44-223-333969; FAX/333992;
MA11@PHX.CAM.AC.UK.
The following errors have been found in my Drosophila
Handbook and Manual. If any further errors are found please bring
them to my attention. Errors are given as page number/line
number; lines are lines of text from the top (+) or bottom (-) of
the page.
Handbook:
22/7+; for "The diploid chromosome number.." read "The haploid
chromosome number.."
87/Table 6.9 legend line 5+. after "(Ref. 23)" insert "; (3)"
99/4- for "Drosophlia" read Drosophila"
99/4- for "larval-curicle" read "larval-cuticle"
99/1- for "Drosophlia" read "Drosophila"
100/3+ for "teisseri" read "teissieri"
377/18+ delete "DCOs"
468/6+ for "+4QCO" read "+6QCO" I thank Scott Hawley for spotting
this mistake.
539/5- for "e[s]" read "e"
928/left column/3+ the "in press" reference is "Proc. Nat. Acad.
Sci. USA 86:6704-6708"
985 Table 32.6 Column headings: these have been badly scrambled,
they should read, from left to right, as follows:
F2 GD sterility (%)
----------------------------
Cross Developmental F1 GD sterility at emergence 15 days 10 days
temperature % at 18 at 28.5
[o]C [o]C [o]C
I thank Dr Ronsseray for bringing this to my attention.
[Editor's note: these headings had to be compressed from
MA's format to stay within the e-mail line length limit; I
hope it is still clear - KM]
1061/right column/4- the "in press" reference is "Cell
59:499-509"
1076 Table 35.1 The totals are incorrect. They should read "3026"
for the Drosophilidae, "442" for the Steganinae and "2572"
for the Drosophilinae.
1088/2- for "Hungarica" read "Hungariae"
1101 section 35/4.5 the correct title for Evenhuis and Okada 1989
is "In Catalog of the Diptera of the Australasian and
Oceanian Regions" ed. N.L. Evenhuis, pp. 609-638.
1130/13+ for "Amiota virosa" read "Amanita virosa"
1181 Fig 37.8 legend. For "D. melanogaster (a); D. simulans (b)"
read "D. simulans (a); D. melanogaster (b)" I thank Robert
Saunders for spotting this error.
1195/2+ for "wolbachia" read "Wolbachia"
1275 left column/29+ delete this line and add ", 924" to line 28+
1276 left column/1+ for "Protease" read "Propargite"
1299 left column/28+ for "Amanitabisporgera" read "Amanita
bisporgera"
1313 left column/35+ for "D. melanogastor" read "D. melanogaster"
(in italics)
1313 left column/36+ delete "4"
Manual
194/4+ add ")" after "1989"
370/11+ ("Injection buffer for embryos (Spradling 1986;
Protocol 136") for "Na phosphate pH 7.8" read "Na phosphate
pH 6.8" I thank Helen Epstein for spotting this mistake.
*** DIN 1
DATABASES/COMPUTING
INTEGRATED DROSOPHILA DATABASES
Daniel Hartl, Dept. of Genetics, Washington Univ. School of
Medicine, Box 8232, 4566 Scott Ave., St. Louis, MO 63110, USA.
314-362-7076, FAX/7855, HARTL_D@WUMS.
On Thursday April 27, 1989, at the 30th Annual Drosophila
Research Conference in New Orleans, Kathleen Matthews organized
an informal discussion of Drosophila databases that was attended
by about fifty individuals, representing various universities,
and Delill Nasser, representing the National Science Foundation.
The discussion focused on the urgent need to integrate Drosophila
data into a common database in view of the rapid rate at which
information was accumulating. The group agreed unanimously that a
Drosophila Database Workshop including Drosophila geneticists and
informatics specialists should be held, and Michael Ashburner and
Daniel Hartl agreed to prepare an application requesting support
from the National Center for Human Genome Research, since
Drosophila is one of the key model organisms. The proposal was
funded, and the workshop was held in Bethesda, MD, December 6-7,
1990.
Approximately twenty individuals participated in the
Drosophila Database Workshop, including experts in various
aspects of informatics, individuals presently involved in
developing an integrated system for sharing genetic data in C.
elegans, and approximately ten Drosophila geneticists variously
involved in maintenance of Drosophila Stock Centers; editorial
oversight of Drosophila Information Service; compilation of
descriptions of mutants, P-element insertions, and chromosome
aberrations; global physical and genome mapping; and maintenance
and dissemination of specialized databases (e.g. clones). The
meeting was also attended by John Wooley and Machi Dilworth,
representing the National Science Foundation, and David Benton,
representing the National Center for Human Genome Research. The
goals of the workshop were to define the next steps toward
integration and dissemination of the databases and to identify a
small nucleus of individuals willing to undertake detailed
planning and implementation of the system.
The extensive data that have accumulated over the past 80
years about the genetics and biology of Drosophila is a
tremendous resource not only to Drosophila researchers but to
researchers working with other organisms. In the past, a small
number of individuals have taken it upon themselves to establish
and maintain parts of these data for the good of the whole
Drosophila community. The individuals who have maintained
"Genetic Variations of Drosophila melanogaster", foremost among
them Dan Lindsley, serve as a fine example of this tradition.
However, complete reliance on the selflessness of individuals may
no longer serve the needs of the field. First, the data are
accumulating too rapidly for single individuals to stay abreast
of without major sacrifice of their own research careers.
Secondly, the data consist of several types, including stock
lists, descriptions of mutations, lists of artificial chromosome
clones, cosmid contigs, DNA sequences, and so on. These databases
constitute a rich resource but are not presently integrated
because they are maintained in different formats. Thirdly, some
of the stalwart volunteers are unable to continue their database
maintenance for personal reasons or because of the vastly
expanded effort required.
Fortunately, there is a long history of cooperation among
Drosophila workers that serves to ease many of the problems
sometimes encountered in data acquisition, integration and
dissemination. Participants in the Drosophila Database Workshop
all agreed that the top priority for a Drosophila database would
be to develop a system for integrating the existing individual
databases. A group consisting of Thomas Kaufman, Michael
Ashburner, William Gelbart, Kathleen Matthews, and John Merriam,
with the assistance of the National Library of Medicine,
represented by James Ostell, agreed to begin the implementation
of these efforts with a view to having a system in operation as
soon as possible.
*** DIN 1
DROSOPHILA GENETIC MAPS
Michael Ashburner, Department of Genetics, Univ. of Cambridge,
Cambridge CB2 3EJ, England. 44-223-333969; FAX/333992;
MA11@PHX.CAM.AC.UK.
Version 9012 of the Drosophila genetic database has been
released. Changes from the previous release are given in the file
MAINDOC.TEXT. Note that Postscript files of this version have not
been released. The database can be obtained electronically from
three sources: the archive fileserver at the Department of
Biology, Indiana University, Bloomington, Indiana and the
Netserver at EMBL, Heidelberg. In addition these files are also
available on the SEQNET facility to registered users within the
United Kingdom. I am very grateful to Don Gilbert at Indiana,
Rainer Fuchs at EMBL and Alan Bleasby at Daresbury for making
this database available in these ways.
The files are:
MAINDOC.TEXT - General documentation (this file)
FUNCTIONDOC.TEXT - Documentation of FUNCTION file
LOCIDOC.TEXT - Documentation of LOCI file
MAPDOC.TEXT - Documentation of MAPLOCI file
SYNONYMDOC.TEXT - Documentation of SYNONYM file
REFSDOC.TEXT - Documentation of REFS file
FUNCTION.TEXT - Genes sorted by function
LOCI.TEXT - Genes sorted by gene symbols
MAPLOCI.TEXT - Genes sorted by genetic map position
SYNONYMS.TEXT - Table of synonyms of gene symbols
REFS.TEXT - References
From Indiana:
The files are kept on IUBIO.BIO.INDIANA.EDU and are accessible by
FTP (File Transfer Protocol). The files are in the directory
[ARCHIVE.FLY.LOCI]. To obtain any of these files use the
following commands:
>ftp iubio.bio.indiana.edu
ftp> user: anonymous
ftp> password: guest
ftp> cd [archive.fly.loci]
ftp> get DOC.TEXT
ftp> get LOCI.TEXT
... et cetera
... or
ftp> mget *.TEXT (to retrieve all TEXT files)
ftp> bye
The numeric address of IUBIO is 129.79.1.101, if your nameserver
is as archaic as some.
From EMBL:
These files are available from the Netserver at EMBL, and if you
do not have the facility for FTP this is the way to get them. For
HELP send an e-mail message to NETSERV@EMBL.BITNET with the text
HELP DROSOPHILA [editor's note: HELP, or other command, must be
in the body of the message, NOT on the subject line - KM]. For a
listing of the files on the EMBL Netserver send the message DIR
DROSOPHILA. To obtain a particular file send an e-mail message
with the text GET FILENAME to NETSERV@EMBL.BITNET, where FILENAME
is one of the filenames listed above.
From SEQNET:
The SERC SEQNET computing facility at the Daresbury Laboratory is
available to researchers in the United Kingdom. This computer
(UK.AC.DL.DLVH) can be directly accessed via JANET. For an
account write to Dr. Alan Bleasby, SERC Daresbury Laboratory,
Warrington WA4 4AD, Cheshire or send e-mail to
AJB@UK.AC.DARESBURY.DLVH. These files are kept in a directory
called DATA1:[DROSOPHILA].
*** DIN 1
UCLA DROSOPHILA GENMAPS DATABASE
John Merriam, Joy Johnsen and Geunbae Lee. Biology Dept., Univ.
of California, 815 Hilgard Avenue, Los Angeles, CA 90024-1606,
USA. 213-825-2256, FAX/206-3987, IBENAPR@OAC.UCLA.EDU.
SUBJECT COVERAGE. The DROSOPHILA GENMAPS DATABASE is an
index to sources of information in Drosophila melanogaster
genetics. The subject coverage is limited to genetics research
done with molecular biology techniques where genetic information
has been localized on the cytogenetic map.
DOCUMENT TYPES. Sources of information include journal
articles, conference reports and personal contacts.
DATES OF COVERAGE. The project began in 1983, but contains
some 1970's citations. The literature coverage has been reviewed
with bibliographic indexing sources for the period 1980-1990.
DATABASE SIZE. The database now includes 857 references
leading to 2683 pieces of localized genetic information. The
project locates sources through bibliographic searches, attending
meetings, and soliciting contacts. The current literature review
has produced 624 new references awaiting indexing decisions,
which will be completed in 1991.
ACCESS IN PRINT. The most current published report is:
Genetic Maps 1990 5th edition, edited by S.J. O'Brien. Cold
Spring Harbor Press. (September 1989 report)
SUPPORT & AFFILIATION: The database project is funded by the
National Library of Medicine on NIH grant LM04896.
THE CURRENT SUMMARY DATABASE REPORT. The ASCII version of
the database report is available on the IUBIO Archive for Biology
via FTP. Follow the instructions in the Ashburner report above,
but substitute the following command for moving into the relevant
directory: cd [ARCHIVE.FLY]. The name of the file is
Clonelist.txt. See the file Clone.readme for further information
about the clone database. To see a list of all files in
ARCHIVE.FLY type DIR.
*** DIN 1
STOCK CENTER DATABASES//IUBIO ARCHIVE FOR BIOLOGY
Kathy Matthews, Indiana Univ. Drosophila Stock Center, Dept. of
Biology, Indiana Univ., Bloomington, IN 47405. 812-855-5782,
FAX/2577, MATTHEWK@IUBACS.
Don Gilbert, an IU Drosophila biologist turned computer
whiz, has established the IUBIO Archive for Biology. To quote
from Don's document, "The Archive will maintain biology software
and data. Molecular biology is the area of concentration. It will
include software for Macintosh, VAX-VMS, Unix, MS-DOS and any
other important computer operating systems. Access to the archive
is via anonymous FTP programs that access computers on the
Internet." Instructions for connecting to IUBIO are given in the
Ashburner article above. To find out more about IUBIO, see
ARCHIVE.DOC in the root directory of IUBIO. Don can be reached at
GILBERTD@IUBACS.
Data relevant to Drosophila are in the directories
ARCHIVE.FLY and ARCHIVE.FLY.LOCI (Ashburner maps only). In
addition to the clone lists also described above, ARCHIVE.FLY
contains lists of the Drosophila stocks held by the stock center
at Indiana. All of the stocks carried at IUDSC are included in
one of the three files FLYLIST.TXT, PLIST.TXT, and NEWP.TXT.
These files are sorted by stock number so you will need some way
to search them. An assortment of files are also posted that
contain subsets of stocks from these tables that are sorted in
some way to make them more accessible (e.g., DEFICIENCIES.TXT
contains all of the deficiency stocks in the collection sorted by
breakpoint). I will be posting more subtables soon. See the
readme files posted in ARCHIVE.FLY for further information about
the stock center lists.
*** DIN 1
GENETIC NOTES
CONVENTIONS FOR THE NAMING OF GENES AND THEIR ALLELES
Dan Lindsley and Georgianna Zimm, Dept. of Biology, Univ. of
California, La Jolla, CA 92093, USA. 619-534-3109, FAX/0053.
Genetic loci, by which we mean the segments of DNA
responsible for single transcription units, are recognized by
virtue of (a) mutant phenotypes, (b) polypeptide products, and
(c) transcripts. Alternative transcripts and polypeptides may
result from a single transcript, and mutant lesions in the same
transcription unit may have different and seemingly unrelated
phenotypes. Ideally each locus is designated by a single name and
symbol. For genes identified by mutations, the designation is a
simple noun or adjective that describes an important and obvious
phenotype of the mutation; the designation is abbreviated with a
one to three-letter symbol (longer in special circumstances) that
begins with the same initial letter as the name. If the phenotype
is recognized in heterozygotes, the mutation is considered
dominant and the designation begins with an upper case letter; if
visible only in the homozygous or hemizygous condition, the
mutation is considered recessive and begins with a lower case
letter. In cases where mutations in the same gene have been
recovered and named independently, they are alleles, and it is
desirable that all be designated by a single name and symbol and
differentiated from one another by superscripts. It is further
desirable that the superscripts be short and simple rather than
complicated acquisition numbers, which are without meaning to all
but the author; information is sacrificed for the sake of
brevity. Deficiencies for genes are not alleles and are therefore
not symbolized as such. In general the rules of priority
determine which of several alternative designations is chosen;
exceptions are where the majority of mutations have a phenotype
different from that used in first defining the locus, or where
the protein produced by the wild-type allele is identified. Other
considerations being equal, the name of the protein encoded is
considered most descriptive of gene function and therefore the
most appropriate designation for a gene. Many genes are known
only from their protein product, i.e., from their wild-type
product. The wild-type alleles are considered to be dominant and
are named after the polypeptide that they encode, using an upper-
case initial letter. The practice of using D as the initial
letter of the symbol for genes encoding Drosophila homologues of
genes originally identified in other species is considered
superfluous and therefore avoided. Loci identified only from
normal transcripts are temporarily named for the transcript,
including in the name the polytene location of the locus, pending
identification of the polypeptide product; here too, an upper-
case initial letter is used. Genes with similar mutant phenotypes
or functions (e.g., lethals, Minutes, Chorion proteins, Heat
shock proteins) are designated similarly but differentiated from
one another with a specific designator such as polytene location
or in some cases of proteins by molecular weight. Members of gene
families (e.g., Actin, Tubulin) are distinguished by polytene
location. In instances where neither the location nor product is
known, arbitrary distinguishing symbols are used.
*** DIN 1
TECHNICAL NOTES
DROSOPHILA CODON TABLES VERSION 10.0
Michael Ashburner, Dept. of Genetics, Univ. of Cambridge, Downing
St., Cambridge, England. (0223)333969, FAX/333992,
MA11@UK.AC.CAM.PHX (invert node order from US).
These Tables are supplied with the understanding that they
can be freely used for research, although if quoted in any
publication a suitable acknowledgement (e.g. Michael Ashburner,
personal communication) would be appreciated. I will
automatically post new versions on the BIOSCI Bulletin Board.
These will generally be compiled whenever enough new data
warrents the work. I am very happy to include new sequences that
have not yet made the Sequence Data Banks, if these can be sent
to me by electronic mail with sufficient data for the coding
sequences to be extracted. If anyone should need the files of
coding sequences that have been used to generate these tables
please send me a message.
Two series of Tables are included, one for "host" genes and
one for orfs carried by transposable elements. For each series
you have a codon table, a base composition and the names of the
sequences used to compile these [Editor's note: the lengthy names
tables have not been included here; if you need this information
send me an e-mail message and I will send you the complete file
as submitted by the author - KM]. By and large these sequences
are taken from the EMBL, GENBANK or DAYHOFF Libraries. However
some have been privately communicated to me. All sequences have
been checked that they translate but many are incomplete. Hence,
for example, the number of sequences is greater than the number
of TER codons. The latest versions of the databanks used are EMBL
V20.0 and GENBANK V61.0. The "host" gene coding sequences are
from a total of 687.482-kb of sequenced DNA.
Table 1A: Base composition of "host" genes:
T=67608 C=96225 Y=0 Pyrimidine=163833
A=82349 G=94852 R=0 Purine=177201
N=9 Nucleotides=341043
Table 1B: Codons of "host" genes:
TTT 1071 TCT 709 TAT 1089 TGT 649 TTC 2719
TCC 2370 TAC 2350 TGC 1790 TTA 351 TCA 674
TAA 109 TGA 40 TTG 1566 TCG 2054 TAG 59
TGG 1104 CTT 777 CCT 729 CAT 1237 CGT 1118
CTC 1417 CCC 2362 CAC 2044 CGC 2051 CTA 705
CCA 1394 CAA 1478 CGA 775 CTG 4341 CCG 1933
CAG 4490 CGG 797 ATT 1658 ACT 893 AAT 2251
AGT 1102 ATC 2963 ACC 2827 AAC 3168 AGC 2238
ATA 675 ACA 947 AAA 1376 AGA 467 ATG 2804
ACG 1522 AAG 4704 AGG 649 GTT 1164 GCT 1710
GAT 3057 GGT 2019 GTC 1747 GCC 4510 GAC 2821
GGC 3735 GTA 533 GCA 1251 GAA 1823 GGA 2376
GTG 3180 GCG 1578 GAG 5074 GGG 502
Total=113676
Table 2A: Codon table TE genes:
TTT 475 TCT 197 TAT 340 TGT 164 TTC 309
TCC 189 TAC 327 TGC 197 TTA 430 TCA 280
TAA 10 TGA 2 TTG 326 TCG 140 TAG 2
TGG 217 CTT 311 CCT 165 CAT 276 CGT 130
CTC 210 CCC 168 CAC 262 CGC 114 CTA 296
CCA 378 CAA 553 CGA 177 CTG 232 CCG 131
CAG 298 CGG 83 ATT 571 ACT 301 AAT 755
AGT 264 ATC 300 ACC 252 AAC 532 AGC 248
ATA 540 ACA 481 AAA 1089 AGA 383 ATG 323
ACG 141 AAG 482 AGG 180 GTT 281 GCT 291
GAT 477 GGT 203 GTC 197 GCC 278 GAC 490
GGC 207 GTA 290 GCA 369 GAA 766 GGA 267
GTG 254 GCG 149 GAG 429 GGG 104
Total=19283
Table 2B: Base composition TE genes:
T=14151 C=11974 Y=0 Pyrimidine=26125
A=20241 G=11483 R=0 Purine=31724
N=0 Nucleotides=57849
*** DIN 1
A SINGLE BASE ERROR IN THE pCaSpeR-BGAL POLYLINKER.
Howard D. Lipshitz[1] and Carl S. Thummel[2], 1- Division of
Biology, 156-29, California Institute of Technology, Pasadena, CA
91125, USA. 818-356-6446, FAX/564-8709. 2- HHMI, Dept. of Human
Genetics, Univ. of Utah Medical Center, Salt Lake City, UT 84132,
USA. 801-581-2937, FAX/581-5374, THUMMEL@MEDSCHOOL.MED.UTAH.EDU.
The P element vector, pCaSpeR-Bgal (Thummel, Boulet, and
Lipshitz, 1988, Gene 74: 445-456), is being widely used for fly
transformation studies. Expression of the B-galactosidase gene in
this vector depends upon the insertion of both a promoter
sequence and downstream translational start codon, fused in-frame
with lacZ. An error is present in the published DNA sequence of
the polylinker region, located upstream of the lacZ coding
region. The sequence in the middle of the polylinker should read:
...GGT/CGA/CTC/TAG/AGG/ATC/CCC/GGG/CGA... This will not affect
the reading frame for EcoRI fusions, but will shift the reading
frame for insertions at the BamHI site. Also, this means that
insertions into the PstI and XbaI sites will not be useful since
there is an in-frame stop codon in the downstream polylinker
sequence. Note that this same DNA sequence is present in the
pCaSpeR-AUG-Bgal polylinker; however, it will not affect
constructions using this vector since it is not within a protein
coding region. We apologize for any inconvenience this may have
caused.
*** DIN 1
P ELEMENT-MEDIATED TRANSFORMATION OF D. MELANOGASTER USING
PURIFIED P ELEMENT TRANSPOSASE
Paul Kaufman and Donald Rio, Whitehead Institute for Biomedical
Research and Dept. of Biology, MIT, Cambridge, MA 02139, USA.
617-258-5242; FAX/5061.
We have recently found that a P element transposase-
containing chromatographic fraction (the 'TdT 0.3M' fraction, as
described in Kaufman, et al., 1989, Cell 59: 359-371) will
efficiently promote P element-mediated transformation upon
microinjection of Drosophila melanogaster embryos. In our hands,
approximately 50% of fertile G[0] injectees yielded transformed
progeny, using the standard 11Kb pDm30 rosy vector.
The transposase used was diluted to approximately 1.5 ug/ml
in our standard chromatography buffer (20 mM Hepes-NaOH, pH 7.6,
20% glycerol, 0.1M KCl, 0.2 mMEDTA, 0.5 mM DTT, 0.05% Nonidet
P-40), supplemented with 25 ug/ml BSA, 70 ug/ml PMSF, 0.2 mM Na
metabisulfite, and 0.5 ug/ml antipain, leupeptin, pepstatin,
chymostatin, and aprotinin. I do not know if all these protease
inhibitors are truly necessary.
We've found that a molar ratio of 0.3-1.0 transposase
molecules per DNA molecule works well; at a ratio of 3.0, many
multiple inserts and dimer inserts are observed. Also, I've used
a final DNA concentration of 0.25 mg/ml, although we haven't
tested others. However, I did all my experiments with the pDm30
vector, and I don't know if the optimal ratio changes with
transposon length.
I prepare the transposase/DNA mixtures by adding 1 ul of 1
mg/ml DNA (in standard injection buffer) to a 3 ul transposase
aliquot on ice; this can either be frozen in liquid nitrogen and
stored at -80[o]C or used directly to load a microcapillary for
embryo injection. I performed injections as per published
protocols, except that I siliconized the microcapillaries
(Drummond Scientific; 75 mm long, OD 1.0 mm, ID 0.75mm) before
use by treating them with 5% dichlorodimethylsilane in CCl[4],
followed by extensive washing with ethanol and drying in a baking
oven. I generally load 2 ul of transposase/DNA mixture for a
day's injections, immediately quick freeze the remainder in
liquid nitrogen, and store it at -80[o]C. Material that remained
in the needle at the end of the day was discarded, but I haven't
directly tested the stability of the transposase activity at
18[o]C. Although we have sent aliquots of transposase to many
groups recently, our resources won't allow us to continue this
practice indefinitely. However, the transposase-overproducing
cell line, MTDelta2-3 (see ref. above), has been placed in the
American Type Culture Collection, #CRL10191. The transposase
purification protocol is also described in above reference.
We would be pleased to know about your results in terms of
the protein/DNA ratio used, efficiency of transformation, or
length of plasmid or cosmid used.
*** DIN 1
TARGETED TISSUE-SPECIFIC EXPRESSION OF GENES IN DROSOPHILA - A P
ELEMENT EXPRESSION SYSTEM THAT USES THE GAL4 ACTIVATOR
Andrea Brand and Norbert Perrimon, HHMI, Dept. of Genetics,
Harvard Medical School, Boston, MA 02115, USA. 617-732-7581,
FAX/7663.
We have developed a two-part system for targeting ectopic
tissue-specific expression of genes during different stages of
Drosophila development. This system depends on the establishment
of two independent fly strains - one strain contains a P element
that expresses the yeast Gal4 activator protein and the second
strain contains the target gene under the control of a Gal4-
inducible promoter. Thus, in one strain, the Gal4 activator
protein is present but has no target gene to activate, and in the
second strain the target gene is silent. When the two lines are
crossed, the target gene is turned on only in the progeny of that
cross, allowing dominant phenotypes (including lethality) to be
conveniently studied.
We have expressed Gal4 in Drosophila in two ways. First,
using the enhancer detector technique Gal4 can be expressed in a
wide variety of patterns in embryos, larvae, and adult flies. We
have established a number of these strains and have shown that
they direct tissue- and cell- specific transactivation of a
Gal4-dependent lacZ gene. Second, to induce expression at
different times during development, we have developed fly strains
carrying a heat-inducible Gal4 gene, using the hsp70 promoter.
Although these flies have background levels of Gal4 expression,
the level is significantly increased upon heat-shock.
We can provide more information and the following materials
to anyone interested in using this expression system. (1) Flies
carrying an enhancerless Gal4 for hopping to different sites in
the genome. (2) Flies that express Gal4 in a specific tissue, if
available. (3) Flies that have a heat-inducible Gal4 gene. (4)
pGATB and pGATN: P elements that contain either a BamHI or NotI
site upstream from the Gal4 coding region. This vector allows the
insertion of tissue-specific promoters for generating a known
expression pattern. (5) pUAST: A P element vector for expressing
the target gene under the control of Gal4. This vector contains
five Gal4 binding sites, the hsp70 minimal promoter (not
heat-inducible), a polylinker with six unique restriction sites
for inserting the target gene, and the SV40 intron and
polyadenylation signal.
Please send requests by FAX, if possible (617-732-7663). A
manuscript is currently in preparation describing this expression
system in more detail.
*** DIN 1
WHOLE MOUNT IN SITU HYBRIDIZATION TO IMAGINAL DISCS USING
DIGOXYGENIN LABELED DNA PROBES
Helmut Kramer and Larry Zipursky, Molecular Biology Institute,
UCLA, 741 Circle Dr., Los Angeles, CA 90024-1570, USA. 213-206-
3750, FAX/5272.
as modified by:
Jim Masucci and Michael Hoffmann, McArdle Labs, Univ. of
Wisconsin, 450 N. Randall Ave., Madison, WI 53706, USA. 608-262-
8854, FMHOFF@VMS.MACC.WISC.EDU.
We have found that Buffer 5 from BMB's Genius Kit works 5
fold better than Vogel buffer, and random primer from Pharmacia
works better than BMB's. Labelling of probes:
Buffer 5: 0.5 M Tris pH 7.2; 0.1 M MgCl[2]; 1 mM DTE; 2 mg/ml
BSA, 3 mg/ml pdN6.
Buffer 6 (=10X nucleotide mix): 1 mM each dATP, dCTP, dGTP;
0.65 mM dTTP; 0.35 mM digoxygenin-11-dUTP.
PBS: 140 mM NaCl; 10 mM KPO[4], pH 7.2.
Use 100-500 ng DNA cut into pieces of less than 400 bases.
1) Combine: DNA, 1 ul Buffer 5, 4 ul pdN6 (25 mg/ml, Pharmacia; 2
ul may be enough), H[2]O to 10 ul. Boil 10 min, quick chill on
ice. 2) Add: 1 ul Buffer 5, 2 ul Buffer 6, 1 ul Klenow, 6 ul
H[2]O. Incubate at 16[o]C overnight. 3) Boil 10 min, chill on
ice, add: 1 ul Buffer 5, 1 ul Buffer 6, 1 ul Klenow, 7 ul H[2]O.
Incubate at 37[o]C for 4 hr. 4) Add: 4 ul 0.5 M EDTA. Heat to
80[o]C for 15 min. 5) Add: 50 ug tRNA, 2 ml PBT (PBS + 0.1%
Tween). Put over centricon 10 (Amicon). 6) Add another 2 mls PBT
and spin in centricon 10 again. 7) Adjust volume so DNA
concentration is 2 ng/ul. 8) Add equal volume of 100% deionized
formamide (probe conc.= 1 ng/ul). 9) Store at -20[o]C.
For hybridizations, use 40 ng/100 ul hybridization volume
for discs or 10 ng/100 ul for embryos.
Staining discs:
Hyb Buffer: 50% deionized formamide; 5X SSC; 200 ug/ml tRNA; 100
ug/ml sonicated, boiled salmon sperm DNA; 0.1% Tween 20. All
steps at room temperature unless noted otherwise.
Staining Buffer: 100 mM Tris-HCl; 100 mM NaCl; 50 mM MgCl[2], pH
9.5 (20[o]C).
1) Dissect discs in PBS for 20 min or less before fixing. Remove
fat body and internal organs but leave discs attached to cuticle
and mouth hooks and place tissue in an eppendorf tube. For
everting discs, dissect discs away from all other structures and
do all the fixations in nets. Transfer with a treated pasteur
pipet to siliconized eppendorf tubes for the hybridizations
(everting discs tend to stick to the sides of untreated tubes).
Treat pipets by pipetting spit through them and rinsing in
distilled water. 2) Fix discs in 4% paraformaldehyde pH 7-7.5
(important!) in PBS for 15-20 min on ice. 3) Fix discs in 4%
paraformaldehyde + 0.6% Triton in PBS for 15 min. (room temp). 4)
Wash discs 3 times, 5 min each in PBT. 5) Digest with 10 ug/ml
proteinase K for 3-5 min. 6) Wash 2 times, 5 min each in PBT + 2
mg/ml glycine. 7) Wash 3 times, 5 min each in PBT. 8) Fix in 4%
paraformaldehyde + 0.2% glutaraldehyde in PBS for 15 min. 9) Wash
5 times, 5 min. each in PBT. 10) Wash in 1:1 mix PBT:Hyb buffer
10 min. 11) Wash in Hyb buffer 10 min. 12) Incubate in Hyb buffer
at least 1 hr at 48[o]C. 13) Heat denature probe and add to a
final concentration of 40 ng/100 ul. 14) Hybridize for 36 hr at
48[o]C in 100 ul Hyb buffer plus probe. 24 hr may be adequate.
15) Wash in Hyb buffer 20 min at 48[o]C. 16) Wash in 1:1 PBT:Hyb
buffer 20 min at 48[o]C. 17) Wash in PBT for 10-12 hr at 48[o]C
changing buffer about 5 times. 18) Leave on ice overnight (not
necessary, but usually convenient). 19) Add 1 ml 1:2000 anti-DIG
antibody from Genius Kit which has been preabsorbed for 1 hr
against fixed larval heads. Incubate for 1 hr. 20) Wash four
times, 2 hr each in PBT. 21) Wash in staining buffer for 15-20
min. 22) Mix 3.5 ul X-phosphate, 4.5 ul NBT (from Genius Kit) per
1 ml staining buffer, add 1 ml to discs and monitor staining. In
general, let staining go a little longer than you think you
should since it appears fainter under higher magnification.
Background determines how long to let it go. I have let staining
go overnight for really light signals with varying degrees of
success. 23) Stop reaction by washing several times in PBT. 24)
Dissect and mount discs in 80% glycerol; seal coverslip with nail
polish.
Conditions to vary when problems with background occur: 1)
Length of fixation - increasing fix time lowers the signal,
including background. 2) Amount of probe - less probe, less
background. 3) New antibody - it can go bad.
*** DIN 1
ANTIBODY STAINING OF IMAGINAL DISCS
Angela Pattatucci and Thom Kaufman, Dept. of Biology and HHMI,
Indiana University, Bloomington, IN 47405, USA. 812-855-7674,
FAX/2577, KAUFMAN@IUBACS.
Fixation and staining protocols that work well for
Drosophila embryos are not optimal for imaginal discs. We recover
uniformly well preserved discs that stain reliably from the
procedure of Glicksman and Brower (1988, Dev. Biol. 127:113-118)
modified as follows. 1) Dissect tissues in Tri-PBS (137 mM NaCl,
2.7 mM KCl, 10.1 mM Na[2]HPO[4], 1.8 mM KH[2]PO[4], 0.2% Triton
X-100, pH 7.5), gather in a 1.5 ml tube of Tri-PBS on ice (at
least 10 animals can be processed in one tube). Tear larvae in
half and invert the anterior portion; remove all gut tissue from
mutant larvae by cutting at the esophagus just anterior to the
proventriculus. Prepare control larvae as above, but leave the
proventriculus attached to the esophagus to serve as a marker,
and process in the same tube with mutant animals. 2) Replace Tri-
PBS with 280 ul PBS, 120 ul 10% paraformaldehyde in PBS, and 500
ul heptane. Shake by hand for 30-45 seconds. 3) Replace first
fixative with 520 ul of PBS, 240 ul of 10% paraformaldehyde in
PBS, and 40 ul of fresh DMSO (freeze aliquots of a freshly opened
bottle; use each frozen aliquot only once); rock for 20 min. 4)
Remove second fix and wash twice with methanol. 5) Replace
methanol wash with 980 ul methanol and 20 ul of 30% hydrogen
peroxide; rock for 30 min. 6) Wash four times in a ml of 0.1% BSA
in Tri-PBS, 10 min. each wash. 7) Replace last wash with 452 ul
Tri-PBS, 5 ul 10% BSA, and 40 ul normal goat serum (NGS); rock
for 30 min. (these volumes work well for primary antibodies used
at concentrations of 1:100 or less; adjust as necessary for
antibodies requiring higher concentrations). 8) Add primary
antibody directly to the tube and rock overnight at room
temperature. 9) Wash tissues 5 times in 1 ml 0.1% BSA in Tri-PBS,
for 5, 10, 15, 20, and 25 min. respectively. 10) Replace last
wash with 445 ul Tri-PBS, 5 ul 10% BSA, and 40 ul NGS, rock for
30 min. 11) For rabbit primary antibodies, add directly to tube
10 ul Fab' goat anti-rabbit HRP conjugate (Protos Immunoresearch)
and rock for 90 min. (substitute appropriate secondary antibody
for non-rabbit primaries). 12) Wash twice, 10 min. each, in 0.1%
BSA in Tri-PBS, followed by three washes in Tri-PBS. 13) Replace
last wash with 450 ul Tri-PBS and 50 ul DAB 5 mg/ml in 0.1 M Tris
pH 7.5; rock for 5 min. (DAB is a carcinogen - wear gloves and
treat all waste as hazardous). Add 5 ul of 0.3% hydrogen peroxide
in water. Monitor color development under a dissecting
microscope. Stop reaction by removing DAB solution and quickly
washing tissue five times with PBS. Dissect discs and mount in
Aqua-Polymount (Polysciences).
*** DIN 1
SINGLE-FLY DNA PREPS FOR PCR
Greg Gloor and William Engels, Dept. of Genetics, Univ. of
Wisconsin, Madison, WI 53706, 608-263-2213, FAX/262-2976,
WRENGELS@WISCMACC.BITNET.
We have developed a simple method for the rapid and
reproducible isolation of DNA from single flies for amplification
by the polymerase chain reaction (PCR) (Saiki et al, Science 239:
487), and direct sequencing by asymmetric PCR (Gyllensten and
Erlich, Proc. Nat. Acad. Sci. 85: 7652). The simplicity of this
procedure means that the problem of contamination with other
amplified or cloned DNA is greatly reduced. Sufficient DNA is
obtained from one fly for a minimum of 50 PCR analyses, and the
DNA is stable for at least one month in the refrigerator. A
simple modification of this technique allows the isolation of DNA
suitable for use in inverse PCR (Ochman et al, Genetics 120:
621-623). These methods substantially reduce the time involved in
DNA isolation, and among other uses, allows the PCR to be used to
monitor the segregation of an allele for which there is no
phenotype or transposition of an unmarked P element (Engels et
al. Cell 62: 515-525).
A. DNA PREPARATION PROTOCOL:
1. The squishing buffer (SB) is 10 mM Tris-Cl pH 8.2, 1 mM EDTA,
25 mM NaCl, and 200 ug/ml Proteinase K, with the enzyme diluted
fresh from a frozen stock each day.
2. Place one fly in a 0.5 ml tube and mash the fly for 5 - 10
seconds with a pipette tip containing 50 ul of SB, without
expelling any liquid (sufficient liquid escapes from the tip).
Then expel the remaining SB.
3. Incubate at 25-37[o]C (or room temp.) for 20-30 minutes.
4. Inactivate the Proteinase K by heating to 95[o]C for 1-2
minutes.
NOTES: This preparation can be stored at 4[o]C for months. We
typically use 1 ul of the DNA prep in a 10-15 ul reaction volume.
It does not matter if fly parts (wings, bristles, legs) are
inadvertantly added to the PCR mixture. Product will typically
start to appear after 24-25 cycles, but 28-30 cycles seems to
give maximal yield. Increasing the number of flies does not seem
to increase the signal significantly, probably due to increasing
concentrations of inhibitors. There should be no problem scaling
up the number of flies screened if the volume is increased
proportionately.
B. DNA PREPS FROM MANY INDIVIDUAL FLIES
A similar method can be used with 96-well (8 x 12) micro plates
to prepare DNA from a large number of individual flies. Up to 80
flies can be tested with a single plate.
1. Place one anesthetized or frozen fly in each well. All rows
(A-H) can be utilized, but leave the first and last columns (1
and 12) empty to ensure complete heating in step 3.
2. Add 50 ul of SB to each well and macerate each fly with a
toothpick for 5-10 seconds. Then cover the plate with an
adhesive-backed strip to prevent evaporation and contamination.
Incubate at room temperature as before.
3. Use two standard-size heating blocks (9.5 x 7.5 cm) pre-heated
to 95[o]C to inactivate the Proteinase K. Sandwich the micro
plate, with its adhesive lid still in place, between the two
heating blocks. The lower block should be inverted so that the
tube holes are facing downward and the flat surface is touching
the bottom of the micro plate. After 2-3 minutes remove the micro
plate and set it on the bench top with the upper hot block still
on top. This upper block will gradually cool to room temperature,
preventing condensation on the underside of the adhesive.
NOTES: It is helpful to tape a piece of waxed paper over the open
micro plate while the PCR tubes are being set up. That way the
DNA samples can be drawn from each well by poking the pipet tip
through the waxed paper. This procedure reduces the possibility
of contamination and helps to keep track of which wells have been
used.
C. INVERSE PCR
PMSF (phenylmethylsulfonylfluoride) can be used instead of the
95[o]C treatment to inactivate the Proteinase K if the DNA preps
are to be used for inverse PCR or other methods that require
double-stranded DNA.
1. Add 1 ul of 0.1 M PMSF to the fly prep following step 3 of
protocol A above. Then heat the mixture to 65[o]C for 10 - 15
minutes to denature any proteins not inactivated by the
proteinase.
2. Add 4 ul of fly supernatant to 16 ul of 1.25X NdeII buffer
(125 mM Tris-HCl pH 7.6, 12.5 mM MgCl[2], 188 mM NaCl, 1.25 mM
DTT). Add 0.5 ul of NdeII (BRL) and incubate at room temp. for 15
min. Inactivate the enzyme by heating to 65[o]C for 15 min.
3. Take 3 ul of digested DNA and add to 7 ul of ligation mix (5
mM MgCl2, 20 mM DTT, 0.8 mM ATP). Add 0.5 ul T4 DNA ligase (NEB)
and incubate at room temperature for 20-30 min. Inactivate the
enzyme by heating to 95[o]C for 2-3 min; this also serves to nick
the DNA.
NOTES: For the first attempt with a new insertion, we recommend
using the following conditions: denature at 94[o]C for 45 sec.,
anneal at 60[o]C for 45 sec., extend at 72[o]C for 4 min; try
30 - 35 cycles. - The restriction enzyme appears to be the most
critical component in this protocol. The enzyme must be specific
under conditions of very low DNA concentration. Sau3A1, for
example, is too promiscuous and digests at several sites in
addition to its canonical restriction sequence. The protocol
should work with other enzymes. The protocol has been used for a
combined inverse/asymmetric PCR procedure to get DNA sequences
flanking P element insertions.
*** DIN 1
TOPICAL INSECTICIDE TEST METHOD FOR DROSOPHILA.
Dave Dapkus, Dept. of Biology, Winona State University, Winona,
MN 55987, USA. 507-457-5274.
Insecticide tests with Drosophila are notoriously variable,
making it difficult to work with insecticide resistance genes. A
test method based on the topical application of insecticide with
a micropipette is described here. The method is very sensitive
and gives reasonably repeatable results.
The basis of the test is application of insecticide
solutions to test flies with a 0-10 ul adjustable Hamilton
pipette (model 84250) equipped with a 2.5 cm blunt-ended needle.
In the test procedure each fly is treated individually with a
0.25 ul sample of insecticide solution. Each dose is picked up
from a holding vial. As the plunger of the syringe is depressed,
a tiny drop forms at the tip of the needle. Touching the drop to
the fly causes the solution to spread out over the body of the
fly, wetting it thoroughly. Test applications are made under 7x
magnification. To avoid possible "wicking" of insecticide
solutions into a porous substrate, applications are made on a
glass microscope slide. Slides are changed after each group of
flies is treated to avoid a possible build-up of insecticide
residue.
Test results seem to vary with the size and nutritional
condition of test flies. Therefore, flies are raised and aged
under optimal conditions: they are grown at low density and aged
for two or three days on heavily yeasted vials before testing.
Female flies are tested since they give less variable results
than males.
The insecticide used in developing this test was DDT
although the method should work well with other non-volatile
insecticides. Serial dilutions are made from a 0.1 gm/ml stock
solution of DDT in acetone to obtain a logarithmic series of
doses in which each dose is 1.14 times as concentrated as the
next lower dose. In one series of tests involving the dominant
resistance factors on one chromosome of a highly resistant
population, 0.59 x 10[-4] to 3.26 x 10[-4] gm/ml solutions
covered the entire range of resistance tests. Solutions are kept
in ground glass-stoppered volumetric flasks. A sample of each DDT
solution is contained in a small 0.5 ml polyethylene centrifuge
tube during the test.
Batches of 10 females are separated out, aged together,
treated at the same time and stored in a common container prior
to scoring mortality. This group of flies is stored on a small (5
cm x 1 cm) plastic petri dish (Gellman model 7242). To avoid
desiccation stress a 2 cm square of paper towel wetted with 30 ul
of tap water is included in each plate. There is little or no
mortality in flies treated with acetone and placed in such
containers for up to 24 hours. Fly mortality is scored at 16 to
21 hours and the proportion dead on each plate is calculated.
Test results vary somewhat from day to day, probably
changing as the growth, aging and test conditions vary slightly.
To minimize the effects of such fluctuations, strains to be
compared are grown side by side in several vials. Several
replicate tests are run on small batches of flies in random
order.
Two different experimental designs are used. In the first, a
series of flies are tested at several DDT doses to get a dose
response curve. A comparison of two strains by this method is
best achieved by testing both strains on the same day from flies
grown and aged together. This method has the advantage of being
the traditional method of resistance analysis and of having well-
established statistical methods for its analysis (Finney, 1971,
"Probit Analysis"). However, it is too time consuming when
several strains are to be compared.
The second method, based on a randomized block design, is
more efficient for comparing larger numbers of strains. In this
method all strains to be compared are tested at a common dose.
Best discrimination is achieved at a dose causing approximately
50% mortality. One useful system is to collect flies, do a
"pretest" at various doses after two days aging and do the actual
test on the third day using a dose determined by the pretest
results.
In this method one replicate of each strain is tested in
random order in each block. The significance of the differences
between the strains can be tested with a two-way analysis of
variance. A sufficient number of blocks is tested to achieve the
desired power of discrimination. The randomized block design is
useful since many test series show significant block effects
which can be removed by the blocking procedure.
In the statistical analysis it is appropriate to transform
such proportion data with an angular transformation (Sokal and
Rohlf, 1981, "Biometrics"). The method can be further improved by
substituting 1/4N for mortalities of zero and 1-1/4N on plates
with 100% mortality, where N is the number of flies on the plate.
This test method and experimental design have been in use
for over a year with good results. The dose needed to kill the
same strain of flies varies, apparently with the flies'
condition. However, comparison of two strains at different times
gives consistent results as long as the flies have been grown and
aged together.
Using these methods it has been possible to detect apparent
single gene segregations in two resistant populations tested. In
these tests, doses that give 50% resistant strain mortality give
near 100% control mortality. Four to eight replicate blocks give
clear cut discrimination between resistant and sensitive strains.
It seems likely that it would be possible to detect considerably
smaller differences in resistance.
*** DIN 1
EQUIPMENT
POPULATION BOTTLE UPDATE.
Dave Dapkus, Dept. of Biology, Winona State University, Winona,
MN 55987, USA. 507-457-5274.
Recent attempts to construct population bottles as described
by Dapkus (1978, DIS 53:209) failed when a supplier for the
plastic milk bottles could not be found. 250 ml wide mouth
nalgene bottles (Scientific Prod.) can be substituted if the
connector is modified. Grind the bottle caps down to 4.5 cm with
a lath or by hand and bore a 3 cm hole through each cap with a
hole saw. Glue caps to each end of a hose connector designed to
join 2 inch I.D. polyethylene hose (available at hardware stores)
with feathering disc contact cement. Mount in the same relative
position by screwing each cap onto a common bottle before gluing.
Also drill a 2 cm hole through the top of the hose connector to
supply air, control excess humidity and allow sampling of the
population; plug with a 3.8 cm foam plug (Carolina Biological
Supply). These units are inexpensive to set up and are easier to
store and maintain than other population cages.
About 60 ml of standard cornmeal/agar medium is placed on a
slant in each bottle. Bottles are changed, alternately, every two
to three weeks. Each unit maintains a population of a few hundred
flies with minimal effort.
The units are ideal for teaching. In a short period of time
students can study several generations of natural selection. A
good method is to establish a mutant population and introduce a
few wild type flies. Each lab group can observe the course of
selection by repeatedly sampling in their "own" population unit
and watching allele frequencies change.
*** DIN 1
DROSOPHILA INFORMATION NEWSLETTER
Volume 2, April 1991
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS (see below). Materials appearing in the
Newsletter will be reprinted, in unedited form, in the next issue
of DIS. Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
many of your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, WT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
*** DIN 2
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail. If
you are on the list and do not wish to receive DIS, or you want
to remove a defunct address, replace SUB in the above message
with UNS. The SUB command can also be used to correct spelling
errors in your real name; the new entry will simply replace the
old as long as it was sent from the same USERID@NODE address.
*** DIN 2
DIN Vol. 2 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Falkenthal Memorial Fund
>DIS Vol. 69 - The Genetic Maps of Drosophila
>DIS Vol. 70 - Traditional DIS
>33rd and 34th Drosophila Research Conferences
>1991/1992 Drosophila Board
>Wisconsin Drosophila Genome Meeting Summary Report
>REQUESTS FOR MATERIALS
>Clones for Drosophila genome project
>Survival data
>Deficiencies for the Bloomington Stock Center
>DATABASES/COMPUTING
>IUBIO - Drosophila information from the network
>GENETIC NOTES
>A modest proposal - Nomenclature for transcription factors
>Autosynaptics made easy
>TECHNICAL NOTES
>New pCaSpeR P element vectors
>Cloning with YACs
>Effect of growth medium on ADH major/ADH minor activity
*** DIN 2
ANNOUNCEMENTS
FALKENTHAL MEMORIAL FUND
Our colleague Scott Falkenthal died last fall. It was
Scott's wish that donations in his memory should be put into an
endowment fund that will be used by the Department of Molecular
Genetics at Ohio State University to support their annual
Graduate Student Colloquium and departmental seminar program.
Donations can be sent to: Scott Falkenthal Memorial Fund, c/o Dr.
Lee Johnson, Dept. of Molecular Genetics, Ohio State Univ., 484
West Twelfth Ave., Columbus, OH 43210-1292.
*** DIN 2
DROSOPHILA INFORMATION SERVICE Vol. 69
William Gelbart, Biological Labs., Harvard Univ., 16 Divinity
Ave., Cambridge, MA 02138-2097, USA. 617-495-2906, FAX/9300.
The Genetic Maps of Drosophila, compiled by Michael
Ashburner, will be published in mid-May 1991 as DIS 69. The issue
is a 400 page compendium of five tables representing the genetic
maps of Drosophila. GENETIC LOCI is a list of the genes sorted
alphabetically. GENETIC MAP is a genetic map sorted by genetic
map position. GENETIC FUNCTION is a list of loci sorted by the
"function" of the gene's product. SYNONYMS is a list of synonyms
with their "valid" genetic symbols. REFERENCES is a table of
references to these data, usually updating Lindsley and Zimm.
Copies of DIS 69 must be prepaid by check in U.S. currency
drawn on a U.S. bank. Make checks payable to DIS-69. Purchase
orders or standing orders cannot be accepted. Domestic shipment
will be by United Parcel Service (UPS) and delivery should take
about one week from time of shipment. Foreign orders may be
placed for delivery by surface mail or air parcel post. Surface
mail will take 6-8 weeks for delivery, while air parcel post will
take 1-2 weeks, depending upon destination. Note however that
foreign air mail will significantly increase the purchase price.
Purchase requests should be received by April 15, 1991. The
size of the print run will be determined at that time by the
number of copies ordered at that time. We anticipate that the
issue will be mailed by the end of May.
Price per copy is $13.00 plus shipping. Add shipping costs
as follows: Domestic UPS - $3.00 per copy. Foreign surface mail -
$6.00 per copy. Foreign air parcel post to: Canada - $7.00 per
copy; Mexico and Central America - $13.00 per copy; South America
- $21.00 per copy; Europe - $23.00 per copy; other foreign
destinations - $27.00 per copy.
Submit purchase requests or make inquiries to DIS-69, c/o
William Gelbart, Editor, at the address above.
*** DIN 2
DROSOPHILA INFORMATION SERVICE Vol. 70
James Thompson, Dept. of Zoology, Univ. of Oklahoma, Norman, OK
73019. 405-325-4821; FAX/7560.
Drosophila Information Service has a long and respected
history of promoting communication among geneticists, ecologists,
systematists, and molecular biologists who focus upon this
species in their research. DIS is a non-profit service to
biologists world-wide. As you know, Philip Hedrick has stepped
down after many years as editor of DIS. I hope you will join me
in thanking him for his efforts. In the interests of maintaining
this useful organ of communication for the Drosophila community,
I have volunteered to become the next editor of DIS. The format
of DIS will remain very similar to those in the past, but some
areas will be added or expanded. * Research notes and new mutant
sections will continue. * Coverage of techniques will be expanded
to include more molecular and cellular techniques. * A group of
assistant editors will be invited to help solicit material and
develop new areas of coverage. * International representatives
will be included to help draw attention to Drosophila activities
world-wide. * Information will be provided on accessing and using
new sources of information, such as the Drosophila Information
Newsletter and computerized stock and clone lists. * Information
on Drosophila Research conferences in the U.S. and abroad will be
included to help promote better communication among all
Drosophila workers. DIS 70 may be ordered by sending a check for
$8.00 (U.S. dollars drawn on a U.S. bank, payable to "Drosophila
Information Service") per copy to the above address.
*** DIN 2
33RD and 34TH DROSOPHILA RESEARCH CONFERENCES
The 1992 Drosophila Research Conference will be held March
10-15th at the Wyndham Franklin Plaza Hotel in Philadelphia, PA,
USA. Bill Gelbart will chair the organizing committee. The 1993
meeting was scheduled to meet at Asilomar, but the large turn out
for Chicago (over a 1000 registered participants; Asilomar has a
theoretical capacity of 800) has caused the board to reconsider.
A final decision has not yet been made, but the choice is between
Asilomar and San Diego. Dates will be announced when available.
Gerry Rubin will be the organizing committee chair for the 1993
meeting.
*** DIN 2
YOUR REPRESENTATIVES ON THE GSA DROSOPHILA BOARD
The Drosophila Board of the GSA meets every year (and
communicates more often by phone) to decide on issues of interest
to the fly community. These issues center, for the most part,
around the arrangements for the annual fly meeting organized by
the GSA, but also cover a variety of other topics, such as the
scope and format of DIS. If you have any questions or suggestions
for the Board, please feel free to contact your local
representative, listed below.
Maine, Vermont, New Hampshire, Massachusetts, Connecticut, Rhode
Island: Terry L. Orr-Weaver, Whitehead Institute, Biomedical
Research, 9 Cambridge Center, Cambridge, MA 02142.
(617) 258-5245, (617) 258-5061 FAX
Downstate New York, New Jersey, Eastern Pennsylvania, Delaware,
West Virginia, Washington, DC, Maryland, Virginia:
Claire Cronmiller, Dept. of Biology, Gilmer Hall Rm. 229, Univ.
of Virginia, Charlotttesville, VA 22901.
(804) 924-7937, (804) 982-2653 FAX
North Carolina, South Carolina, Georgia, Florida, Alabama,
Mississippi, Kentucky, Tennessee, Louisiana, Puerto Rico:
John C. Lucchesi, Dept. of Biology, Univ. of North Carolina,
Chapel Hill, NC 27599. (919) 962-1332, (919) 962-1625 FAX
Minnesota, Wisconsin, Iowa, Illinois, Indiana, Missouri:
Kathleen Matthews, Dept. of Biology, Indiana University,
Bloomington, IN 47405. (812) 855-5782, (812) 855-2577 FAX
Upstate New York, Toronto, Ohio, Western Pennsylvania, Michigan:
Mariana F. Wolfner, Section of Genetics and Development,
Biotechnology Building, Cornell University, Ithaca, NY 14853.
(607) 254-4801, (607) 255-2428 FAX
Utah, Colorado, Kansas, Nebraska, North Dakota, South Dakota, New
Mexico, Texas, Arizona, Oklahoma, Arkansas, Louisiana:
Steve Cohen, Dept. of Cell Biology, Baylor College, 1 Baylor
Plaza, Houston, TX 77030. (713) 798-5019, (713) 790-1275 FAX
Oregon, Washington, Idaho, Montana, Wyoming, Alaska:
Steven Henikoff, Hutchinson Cancer Research Center, 1124 Columbia
St., Seattle, WA 98104. (206) 667-4515
California, Hawaii, Nevada:
John R. Merriam, Dept. of Biology, University of California, Los
Angeles, CA 90025. (213) 825-2256, (213) 206-3987 FAX
Canada:
Thomas Grigliatti, Department of Zoology, Univ, of BC, #2354-6270
University Blvd., Vancouver, BC, Canada, V6T 2A9. (604) 228-2161
*** DIN 2
DROSOPHILA GENOME MEETING SUMMARY REPORT - ABSTRACT (the complete
report is posted on IUBIO in ARCHIVE.FLY.NEWS)
William Reznikoff, Dept. of Biochemistry, Univ. of Wisconsin,
Madison, WI 53706-1569, USA. 608-262-3026.
Drosophila melanogaster is one of the prime model organisms
for the human genome initiative. In order to develop an outline
of the current state of genome analysis in the Drosophila
community, to suggest some possible goals of Drosophila genome
research and to consider possible strategies for achieving these
goals, a workshop was held in Madison, Wisconsin, on August 3-5,
1990, with the support of the National Center for Human Genome
Research, NIH, and the University of Wisconsin Graduate School.
Although the participants in the workshop were limited in number,
the organizers did try to ensure that scientists from various
specialties and a variety of institutions were invited to achieve
a reasonable representation of the Drosophila research community.
In addition to scientists from the Drosophila community, the
workshop was also attended by representatives from the C. elegans
genome initiative, and by experts in sequence technology and
biocomputing. The workshop participants decided to publish a
summary version of its report because of the importance of the
issues raised and the limited participation. We invite comments.
The workshop started with a challenge--why initiate a large
scale genome project during a time of tight funding for very
productive individual projects? The workshop participants
returned to this concern throughout the meeting. The workshop
participants felt that if any funds were being allocated for the
genome initiative, then the Drosophila projects should represent
a high priority for those funds. Drosophila is unique amongst
multicellular organisms for the genetic information available and
genetic, molecular and developmental research currently being
pursued. This means that well designed sequencing projects
targeted on any of several genetically well-characterized
chromosome regions are likely to yield important data which are
easily interpreted and of significant usefulness to the research
community. Many of the complex biological processes found in
humans are also found in Drosophila. Its powerful genetic system
coupled with a sequence analysis of selected regions is likely to
provide important clues to the genetic control of the analogous
processes in humans. Drosophila is also unique in that the
polytene chromosomes already provide a high resolution physical
map to which the molecular map may be easily aligned. The P
element and other similar transposons are already proven to be
powerful tools for further enhancing genetic research and provide
new methods for accessing the DNA for physical mapping and
sequence analysis. This technology can serve as a model for
similar approaches in other organisms. Finally, the Drosophila
genome is of a size which allows one to reasonably consider a
complete sequence analysis.
The workshop included reports from currently funded and
proposed Drosophila genome projects, discussion of genome
analysis work being done on the C. elegans and E. coli systems,
reports on the current initiatives to manage information and
strain maintenance and distribution, and a description of
advanced sequencing technologies. The workshop participants wrote
a report which is available through the National Center for Human
Genome Research, NIH.
The fruits of science must be increased public knowledge.
The genome initiative presents unusual challenges in realizing
this obligation. Ongoing genome projects should be configured
such that they share information with each other and make
available in a timely fashion data to the Drosophila community.
This means that a high priority should be placed on the
development and maintenance of informatics systems which can
provide many forms of access, including hard copy and on-line
reports. It is hoped that a frequently updated database relating
known genes, P element insertion points, genetic rearrangements,
polytene map locations, YAC and cosmid maps, and sequences, will
be available. In addition, the participants in this workshop
found that this type of meeting could also serve an important
role in sharing the genome project with the Drosophila community.
We suggest that annual workshops should be part of the genome
initiative. It is important that such meetings have attendance by
members of the Drosophila community who are not directly involved
in genome projects. Such participation will help disseminate the
fruits of the initiative and will help to refine the priorities
to reflect the changing needs of the community.
*** DIN 2
REQUESTS FOR MATERIALS
REQUEST FOR CLONES
Leonard Rabinow[1] and Robert Saunders[2]. [1]Waksman Institute,
Rutgers Univ., Piscataway, NJ 08855-0759, USA. 908-932-0091/0092,
FAX/5735, RABINOW@BIOVAX. [2]Dept. of Biochemistry, Univ. of
Dundee, Dundee DD1 4HN, UK. (0382)23181 ext. 4790, FAX/201063,
BI31@UK.AC.DUNDEE.PRIMEB (reverse node order from USA).
Most readers of DIS are probably aware of a number of
projects in progress with the aim of constructing a physical map
of the Drosophila melanogaster genome. A collaboration among the
laboratories of F.C. Kafatos, C. Louis, C. Savakis, D.M. Glover,
and M. Ashburner is proceeding by fingerprinting cosmids selected
with cytological division-specific probes produced by
microdissection from polytene chromosomes (Nucl. Acids Res.
(1990) 18, 6261-6270). J. Messing, L. Rabinow, W. Sofer and G.
Hamm at the Waksman Institute, are initiating a project to
produce a restriction map of the genome, using bacteriophage P1
and automated reading of partial restriction digests.
Both projects will correlate their developing physical maps
with the genetic and cytological maps of Drosophila. To achieve
this, we would like to probe our libraries with loci cloned and
mapped by members of the Drosophila community. We would greatly
appreciate it if members of the fly community willing to
contribute clones would send them to either of the above
addresses. It would be most convenient if clones could be sent in
plasmids (preferably bearing T7, SP6 or T3 RNA polymerase
promoters), or M13, to avoid cross-hybridization problems. A few
micrograms of a specific oligonucleotide, if available, could
also be used. Submissions would be most useful if accompanied by
information on the name, identity, and location of the clone, its
vector, a restriction map or sequence, and a reference. To
coordinate the overall efforts, clones and data will be exchanged
among these groups. Submitted clones will be exchanged only
between these two groups, unless specifically authorized by the
sender.
*** DIN 2
DEFICIENCIES FOR THE BLOOMINGTON STOCK CENTER
Kathy Matthews, Dept. of Biology, Indiana Univ., Bloomington, IN
47405. 812-855-5782, FAX/2577, MATTHEWK@IUBACS.
The Drosophila collection at the Bloomington Stock Center
currently carries 512 deficiency stocks. Our "Deficiency Kits"
consist of the minimum set of these deficiencies that cover the
maximum amount of the genome. The kits for the X and the three
autosomes currently consist of 142 stocks - 40 in DK1, 49 in DK2,
51 in DK3, and 2 in DK4. Together these lines provide coverage
for about 60% of the euchromatin. We would like to fill as many
of the existing gaps in coverage as possible. Regions of the
polytene chromosomes that are either NOT covered by the current
collection, or the breakpoint uncertainty for deficiencies we do
have is such that coverage is doubtful, are shown below. If you
have deficiencies that help fill any of these gaps and are
willing to share them with your colleagues, please send them to
the stock center.
005A01-005A08, 005D05-005E03, 006B01-006E04, 007C03-007D01
007D05-007D10, 008C06-008E12, 011F01-011F10, 012A01-012A10
012F05-013F01, 014B01-014B06, 015A06-017A01, 018A02-018A05
021B07-021C01, 021D05-024A03, 025C08-025D02, 026A08-027E08
028C01-031A03, 032C01-032F01, 034A01-034B12, 035E06-036A08
036E01-036E04, 040A04-041F11, 041A01-042A16, 044E02-046C03
046C09-047D03, 049F15-051A08, 051B06-051C03, 052F10-055A01
055F01-056D15, 056F01-056F09, 058B01-059D08, 060A07-060C06
060D09-060E03, 061A01-062B07, 062B12-062F12, 063E01-066D10
066E01-066F05, 067D07-067F03, 069B04-070A03, 070A05-070B07
070D06-070D07, 074F01-075B03, 075C01-076A03, 076B02-077A01
077F01-078A03, 079A04-080E03, 081F01-083C01, 085B06-085D08
085F06-086C01, 088E05-089A01, 090A01-090D01, 092D03-093B05
094A01-094F06, 095A01-096A07, 096A21-097A10, 098A01-099B11
100B04-100F05, 101A01-101E09, 102B10-102E02, 102E10-102F17
*** DIN 2
DATABASES/COMPUTING
IUBIO - DROSOPHILA INFORMATION FROM THE NETWORK
Kathy Matthews, Dept. of Biology, Indiana Univ., Bloomington, IN
47405. 812-855-5782, FAX/2577, MATTHEWK@IUBACS.
A variety of information useful to Drosophilists is posted
on IUBIO, our Department of Biology micro-VAX, and is available
to the public via anonymous FTP (File Transfer Protocol) on the
Internet. In addition to current stock lists from the Bloomington
Stock Center, the following Drosophila-oriented information is
maintained on IUBIO: Michael Ashburner's genetic maps (if you
don't want to wait for DIS 69, or need an update later) and his
most recent Drosophila codon bias table; John Merriam's GenMaps
database (generally known as the clone list, but contains a lot
of other useful information in addition); news items such as back
issues of DIN and the full text of the report from the Wisconsin
genome meeting. If you are interested in posting information on
IUBIO, contact IUBIO founder and archivist, Don Gilbert. Don can
be reached at ARCHIVE@IUBIO.BIO.INDIANA.EDU (preferred address)
or GILBERTD@IUBACS.
To retrieve information from IUBIO, the following
instructions work for most people/computers, but note that you
must have access to the Internet. From your system prompt, type:
FTP IUBIO.BIO.INDIANA.EDU (this connects you to IUBIO using FTP
software on your local computer)
user: ANONYMOUS (spell it correctly or it won't work)
password: YOUR REAL USER NAME (anything works)
CD [.FLY] (cd = change directory; Drosophila info is in
the FLY directory)
DIR (this shows file and subdirectory names)
GET FILENAME (use this command to copy one file at a time)
or
MGET *.README (to get all of the readme files; you will be
asked to confirm each file, but it's still
easier than typing each filename; MGET
doesn't work between the VAX and a PC)
MGET *.TXT (to get all of the data files)
BYE (to log off)
Ashburner's map lists are in the subdirectory LOCI. To copy
these, type CD [.FLY.LOCI] and continue. His data files have the
extension .TEXT instead of .TXT, so use the command MGET *.TEXT
for these files. For news items, type CD [.FLY.NEWS] and use GET
FILENAME to copy the files you are interested in. If you want
files placed in a particular subdirectory on your local account,
type LCD SUBDIRECTORY NAME (the complete path if you are working
from a PC) before giving the GET command.
*** DIN 2
GENETIC NOTES
A MODEST PROPOSAL - NOMENCLATURE FOR TRANSCRIPTION FACTORS
Dan Lindsley, Dept. of Biology, Univ. of California, La Jolla, CA
92093. 619-534-3109, FAX/0053.
A modest proposal: As biochemically identified transcription
factors in Drosophila are cloned and mapped by in situ
hybridization to polytene chromosomes they be designated by Trf
followed by the polytene location of the encoding gene. This
nomenclature would apply to gene products whether they are
subunits of heteromultimeric proteins or function as monomers or
homomultimers. Thus, for example, the gene named Elf-1 by Bray,
Burke, Brown, and Hirsh (1989, Genes Dev. 3:1130-45) and Ntf by
Dynlacht, Attardi, Admon, Freeman, and Tjian (1989, Genes Dev.
3:1677-88), and so designated in the upcoming revision of the Red
Book, would be designated Trf54F. Major developmental mutants
shown to function in the regulation of transcription would remain
named according to the phenotype of the mutants by which they
were originally identified.
*** DIN 2
AUTOSYNAPTICS MADE EASY
David Gubb[1], John Roote[1], Darin Coulson[1], Claire
Henchcliffe[2], Terry Lyttle[3] and Bruce Reed [1]. [1]Dept. of
Genetics, Univ. of Cambridge, Cambridge CB2 3EH, UK. 44-223-
333969, FAX/333992, DG27@UK.AC.CAM.PHX (invert node order from
USA). [2]Howard Hughes Medical Institute, Dept of Biochemistry,
Univ. of California, Berkeley, CA 94720, USA. 415-642-9402,
FAX/3-5548. [3]Dept. of Genetics and Molecular Biology, Univ. of
Hawaii, Honolulu, Hawaii 96833, USA. 808-948-7860, LYTTLE@HUCCVX.
The possibility of using autosynaptic chromosomes is a
relatively new addition to the techniques available to the
Drosophila geneticist. Developed by Loring Craymer through his
work on the manipulation of pericentric inversions (1981,
Genetics 99: 75-97), autosynaptics are attractive as an
alternative to T(Y;A)s for generating synthetic duplications and
deletions (Lindsley and Sandler et al. 1972, Genetics
71:157-184), but with the advantage that the heterochromatic
breakpoints are autosomal.
As defined by Craymer (1981), autosynaptic chromosomes are
the aneuploid products of recombination between a pericentric
inversion and a cytologically wild-type chromosome. On Craymer`s
terminology, the left- and right-hand breakpoints of a standard
"heterosynaptic" inversion are separated onto homologous
centromeres to give reciprocal "levosynaptic (LS)" and
"dextrosynaptic (DS)" elements. The LS element will be homozygous
for the left arm chromosomal regions distal to the inversion
breakpoint which will pair "autosynaptically". The complementary
LS + DS elements form a euploid autosynaptic "constellation"
which is indistinguishable cytologically from the same inversion
in the heterosynaptic form.
Among other attributes, autosynaptic chromosomes can form
the basis for self-selecting screens designed to recover new
chromosome breakpoints within a defined cytological region (Gubb,
McGill and Ashburner, 1988, Genetics 119: 377-390).
What follows is a list of available stocks that we have
constructed, with suitable genetic marker mutations, and, one
hopes, a simple explanation of their use. In order to simplify
the construction of segmental aneuploids, the pericentric
inversions used were chosen to have one breakpoint in euchromatin
and the other within the centric heterochromatin. There are two
advantages in this approach. Firstly, a large number of
inversions of this type were available, because the centric
heterochromatin is a large target area for chromosomal
breakpoints. Secondly, because aneuploidy for centric
heterochromatin has little effect on viability, only the position
of the single euchromatic breakpoint need be considered in the
construction of segmental aneuploids.
When two autosynaptic stocks are crossed together there are
only two potentially viable classes of progeny, one carrying a
deletion and the other a duplication. Thus:
LS(2)A//DS(2)A X LS(2)B//DS(2)B -> LS(2)A//DS(2)B +
LS(2)B//DS(2)A. (The remaining products, LS(2)A//LS(2)B and
DS(2)A//DS(2)B will be grossly aneuploid and embryonic lethal.)
In our set of stocks care has been taken to ensure that these
classes may be distinguished from each other by appropriate
choice of markers. In many crosses only the duplication class
will survive. It is, however, simple to recover additional
chromosomes with breakpoints in the region surrounding an
existing autosynaptic breakpoint using either P-element or X-ray
mutagenesis (Gubb, McGill and Ashburner, 1988 Genetics
119:377-390). These additional stocks will allow deletion mapping
of the region in question. We have listed below our set of
autosynaptic stocks with euchromatic breakpoints on the left arm
of chromosome two. These stocks have been sent to the Bloomington
stock center from where they are available on request. The list
gives the Bloomington stock designation, #, and includes one
stock made by L. Craymer, # 1166. Many of the inversions used
were originally isolated by W. Gelbart and co workers (thank you
Bill et al.).
#1166 LS(2)S[325]. In(2L)Cy, Cy E(S)//DS(2)S[325],, Sco 21F;41*
#3537 LS(2)DTD18, ho[2]//DS(2)DTD18, cn bw 23A4-7;41
#2477 LS(2)DTD21, ho[2]//DS(2)DTD21, cn, {dp} 23A1.2;41
#3538 LS(2)DTD16,, dp//DS(2)DTD16, bw, dp 23B;41**
# 865 LS(2)DTD8, {net}//DS(2)DTD8, sp 23C-D1;41
#3202 LS(2)DTD42, {net}//DS(2)DTD42, bw sp 23E3-6;41
#3067 LS(2)DTD52//DS(2)DTD52, vg 24D1.2;41
#2427 LS(2)DTD124,, b//DS(2)DTD124, cn, b 24D2-3;41
#3535 LS(2)DTD109, {fy[2]}//DS(2)DTD109, bw 25E2-3;41
#3536 LS(2)DTD116, {net}//DS(2)DTD116, sp 26A4-6;41
#558 LS(2)DTD24, {net}//DS(2)DTD24, bw sp 26C1.2;41A
#3539 LS(2)DTD51. In(2L6)Cy//DS(2)DTD51, cn bw, {b} 27D1;41
#3540 LS(2)DTD11//DS(2)DTD11, sp 28A;41
#3541 LS(2)DTD111. In(2L)Cy, {al[2]} Cy {pr}//DS(2)DTD111, vg
29F;41AB
#3551 LS(2)DTD125, net//DS(2)DTD125, bw sp 31E;41
#1660 LS(2)DTD107, In(2L)DTD107 {TE52 ho[2]}. dp//DS(2)DTD107,
bw 32F;41
#3534 LS(2)DTD4, fy[2]//DS(2)DTD4, bw 32F;41AB
#3552 LS(2)DTD86, Bl//DS(2)DTD86, {cn} 33B1.2;41
#3550 LS(2)b81a2//DS(2)b81a2 34D;41D//34E3;41D
#2047 LS(2)D20, {net dp b}//DS(2)P9, {pk cn sp}, pr 34E4-F2;41/
/34B7-12;41D
#3549 LS(2)DTD43, ho[2]//DS(2)DTD43, bw sp 35B1.2;41
#3542 LS(2)D9, dp b//DS(2)D6 35B1-3;41//35D5-7;41
#3544 LS(2)ScoR+9//DS(2)D2, cn bw; C(1)M4, y[2] 35D1-2;41/
/34D4.5;41B3-9
#2089 LS(2)D5//DS(2)CH25 36C1;42F//36C;41
#2040 LS(2)P3,,{pr}//DS(2)noc[4], cn bw 37B.2;41CD//35B1.2;41A
#1052 C(2L)C3, b pr; C(2R)C1, sple 40DE;41A
* S[325] breakpoint was induced within Dp(2;2)S thus both LS and
DS may carry a small duplication.
** LS also carries Df(2L)DTD16 24D3-E1.
{} We have used curly brackets to indicate that the enclosed
allele, {net} for example, was present on one of the
heterosynaptic chromosomes from which the autosynaptic chromosome
was derived, and is thus heterozygous in the autosynaptic stock.
The position of marker mutations relative to the inversion
breakpoints is indicated by commas: LS(2)DTD125, net is
homozygous for net which maps distal to the 31E breakpoint of
DTD125. Similarly, DS(2)DTD124, cn, b carries cn distal to the 41
breakpoint and b proximal to the 24D2-3 breakpoint i.e., within
the heterosynaptic region of the DS element.
There are a few occasions, when heterozygous dominant
markers are used, where this nomenclature would remain ambiguous.
In such cases the position of the centromere is indicated by a
period.
A similar set of chromosomes for the right arm of the second
chromosome is currently being constructed in Cambridge. The
available stocks are:
LS(2)lt[G16],, lt stw cn bw//DS(2)lt[G10],, lt cn 40;60E5-8/
/40;59F3-4
LS(2)lt[G10], b el, bw//DS(2)lt[G10],, lt {cn} 40;59F3-4
LS(2)lt[G16],, lt stw cn bw//DS(2)bw[v32g], bw, lt[v] {sp}
40;60E5-8//40;59E
LS(2)bw[v32g], net bw//DS(2)bw[v32g], bw, lt[v] {sp} 40;59E
LS(2)Pu[L]//DS(2)Pu[L], {or} If 40;57B-C
These stocks can be obtained from Bruce Reed (e-mail:
BR106@UK.AC.CAM.PHX, invert node order from USA). The Craymer
stock LS(2)f6//DS(2)f6 39D3-E1;48F6-49A1 (available from
Bloomington as stock #1231) fits in with this 2R series.
EXAMPLES OF THE USE OF AUTOSYNAPTIC STOCKS TO GENERATE SEGMENTAL
ANEUPLOIDS.
1) To generate the reciprocal duplication and deletion between
23A1.2 and 23C-D1, flies of stock #2477 are crossed to flies of
stock #865. The progeny should be phenotypically cn (Dp
23A1.2;23C-D) or ho[2] sp (Df 23A1.2;23C-D). Thus: #2477
LS(2)DTD21, ho[2]//DS(2)DTD21, cn, {dp} X #865 LS(2)DTD8, {net}//
DS(2)DTD8, sp --> LS(2)DTD8, {net}//DS(2)DTD21, cn, {dp} (Dp
23A1.2;23C-D) + LS(2)DTD21, ho[2]//DS(2)DTD8, sp (Df 23A1.2;23C-
D). These two classes of aneuploid autosynaptic flies can be
maintained as stable stocks. The corresponding heterosynaptic
inversions can be recovered by mating virgin female autosynaptic
flies to normal (heterosynaptic) males. Thus: LS(2)DTD8,
(net)//DS(2)DTD21, cn, {dp} X CyO/Gla ->
In(2LR)DTD8[L]DTD21[R], {net} dp cn/CyO (or Gla) + {net} dp
cn/CyO (or Gla).
It is likely, although not certain, that the net mutation
will be carried on the cytologically wild-type chromosome rather
than the aneuploid inversion. (The net mutation was introduced
into the autosynaptic constellation by crossing In(2LR)DTD8/net
sp to an autosynaptic stock. It would be possible to lose the net
mutation by recombination within the LS element distal to the
inversion breakpoint. This would be a rare event as the net
mutation is relatively close to the breakpoint and, in practice,
we have been unable to select for homozygous net flies in the
autosynaptic DTD8 stock.)
2) Similarly the cross between #3534 and #3549 will give ho[2] bw
flies that carry Dp 32F;35B1.2. Flies of the reciprocal class, Df
32F;35B1.2, will not survive, as deletions of this length are
lethal. If deletions in the 32F;35B1.2 region were required, then
the hyperploid autosynaptic stock LS(2)DTD43, ho[2]//DS(2)DTD4,
bw could be used to recover additional autosynaptic elements with
breakpoints within the duplicated interval, by mutagenesis (Gubb,
McGill and Ashburner, 1988 Genetics 119:377-390).
As in the previous example, the hyperploid autosynaptic
(DTD43//DTD4) can be resolved to the equivalent hyperploid
heterosynaptic inversion, In(2LR)DTD43[L]DTD4[R], by mating
autosynaptic females to normal males. Unfortunately, the two
resolved products of this autosynaptic are phenotypically
indistinguishable, but can be identified by cytology. Hyperploid
pericentric inversions such as In(2LR)DTD43[L]DTD4[R] can be
particularly useful in screening for haplo-lethal or haplo-
sterile mutations as they will act as balancer chromosomes for
the duplicated regions.
The problem of distinguishing between the euploid and
aneuploid products of resolution of an autosynaptic stock without
resorting to cytology does not arise with inversions that have a
dominant mutation associated with one of their breakpoints. For
example:
w; LS(2)ScoR+1, net//DS(2)TE146-SZ4, cn, pr, which carries a w[+]
rst[+] transposable element (TE146 of G. Ising) associated with
the DS breakpoint. If females of this stock are crossed to w;
Gla/CyO males, the euploid heterosynaptic progeny are
phenotypically white-eyed while the aneuploid progeny are red-
eyed.
We are currently generating a set of stocks carrying the
w[+] gene within a single P{w[+]} construct element at the
inversion breakpoints. With these stocks, as with the above
example, the w[+] phenotype will identify the aneuploid In(2LR)
product of resolution of the autosynaptic stock.
*** DIN 2
TECHNICAL NOTES
NEW pCaSpeR P ELEMENT VECTORS
Carl S. Thummel[1] and Vincenzo Pirrotta[2]. [1]HHMI, Eccles
Institute, Bldg. 533, Univ. of Utah, Salt Lake City, UT 84112,
USA. 801-581-2937, FAX/5374, THUMMEL@MEDSCHOOL.MED.UTAH.EDU; [2]
Dept. of Cell Biology, Baylor College of Medicine, 1 Baylor
Plaza, Houston, TX, 77030, USA. 713-798-6635, FAX/790-1275,
PIRROTTA@BCM.TMC.EDU.
We have modified the pCaSpeR P element vector to include a
variety of unique restriction sites in the polylinker and also
constructed two derivatives with the hsp70 promoter. As with the
original pCaSpeR vector, these plasmids contain pUC sequences for
propagation in bacteria and two P element ends flanking a white
minigene and multiple cloning site. pCaSpeR 2 and pCaSpeR 3
contain a 39 bp oligonucleotide fragment in either of two
orientations to introduce 5 new unique sites into the polylinker.
pCaSpeR 4 contains the pW8 polylinker from the Gehring lab
(Klemenz et al. (1987) Nuc. Acids Res. 15:3947-3959). pCaSpeR-hs
is designed to allow heat-inducible expression of an inserted
open reading frame. This P element contains an hsp70 promoter,
multiple cloning site, and hsp70 3' trailer. The hsp70 3' trailer
both reduces the accumulation of stable mRNA under non-heat shock
conditions and allows the mRNA to induce to high levels following
heat shock. pCaSpeR hs43 lacZ contains the lacZ reporter gene
transcribed from a minimal promoter consisting of the hsp70 TATA
box (deleted at -43) and leader sequences. It is derived from
pCaSpeR 4 and is intended for testing enhancers and tissue-
specific regulatory elements. The arrangement of restriction
sites in these vectors is as follows, sites written in capital
letters can be used for inserting DNA:
pCaSpeR:
HindIII/PSTI/SalI/XBAI/BAMHI/SmaI/SstI/ECORI
pCaSpeR 2:
HindIII/PSTI/SalI/XBAI/BAMHI/SmaI/SstI/STUI/XBAI/SSTII/NOTI/BGLII
/HPAI/ECORI
pCaSpeR 3:
HindIII/PSTI/SalI/XBAI/BAMHI/SmaI/SstI/ECORI/HPAI/BGLII/NOTI/
SSTII/XBAI/STUI
pCaSpeR 4:
HindIII/PSTI/SalI/XHOI/STUI/XHOI/HPAI/SalI/XBAI/BAMHI/SPEI/SFII/
NOTI/SSTII/SmaI/KPNI/ECORI
pCaSpeR-hs:
hsp70 promoter/ECORI/HPAI/BGLII/NOTI/SSTII/XBAI/STUI/hsp70 polyA
and 3' flanking
pCaSpeR hs43 lacZ:
ECORI/KpnI/SmaI/SSTII/NOTI/SFII/SPEI/BAMHI/XBAI/SalI/HPAI/XHOI/hs
p43 promoter/PSTI/KpnI/SalI/SmaI/AUG lacZ
*** DIN 2
CLONING OF LARGE SEGMENTS OF THE DROSOPHILA MELANOGASTER GENOME
USING YEAST ARTIFICIAL CHROMOSOMES
D. Filipp, G.L. Kogan, E.S. Belyaeva, B.A. Leibovitch, I.P.
Arman, V.A. Gvozdev, Institute of Molecular Genetics, Acad. Sci.
USSR, Moscow.
A partial genomic library from the Batumi L stock of
Drosophila melanogaster was constructed using yeast artificial
chromosome vectors. The DNA was restricted with NotI and large
fragments were inserted into the YAC5-vector (Burke, Carle, and
Olson, 1987, Science 236: 806). The sizes of cloned DNA varied
from 90 to 500 kb.
38 random clones were characterized by in situ hybridization
to Batumi L salivary gland polytene chromosomes. Single
euchromatic sites of hybridization were detected for 27 clones.
The remaining 11 clones showed a main euchromatic site of
hybridization and several additional sites scattered along the
chromosomes (see list below). The clone DY 52 (500 kb) may have
originated from the Y chromosome and DY 56 (90 kb) from the
nucleolus. Any of the YAC clones described below are available to
other investigators on request to Dr. G. L. Kogan. The inserts
are, on average, 100 kb in length with a few that are 200 kb in
length.
Cytogenetic location of YAK hybridization: 1C+chromocenter,
5AB+chromocenter, 9C, 18DEF, 21CD, 28E, 34AB, 34C, 34D, 37AB,
44CD, 44D, 45E, 46AB+60BC, 46C, 46DEF+44D+98F+nucleolus, 47F,
48D, 52EF, 53A, 54A, 54CD, 54CD+nucleolus, 58EF,
59A+chromocenter, 60C, 61C+chromocenter+4th chromo, 61DE, 63E,
63E+1BC+62B, 65E+100A, 69F, 71C+chromocenter, 77E, 79E+76E+93A,
89A, 89B, 90DEF.
*** DIN 2
EFFECT OF GROWTH MEDIUM ON ADH MAJOR/ADH MINOR ACTIVITY
Leonard Borack[1], Richard Friedman[2], and William Sofer[2],
[1]Dept. of Biol. Sci., Rutgers University, Newark, New Jersey
07102, USA. 201-648-5359. [2]Waksman Institute, Rutgers
University, Piscataway, New Jersey 08854, USA. 201-932-3052,
SOFER@MBCL.RUTGERS.EDU.
Extracts of D. melanogaster third instar larvae of Canton S,
WEP (Adh[F]), Adh[D], or Adh[fn6] somatic transformants, raised
on Instant Drosophila Medium (Carolina Biological) show ADH[S],
ADH[F] and ADH[D] minor form activity to be approximately 7% that
of the corresponding ADH major form. Extracts of larvae raised on
a Cornmeal-sucrose-molasses medium show ADH[S], ADH[F] and ADH[D]
minor form activity at approximately 20% that of the
corresponding ADH major form. After electrophoresis, ADH[F] major
and ADH[S] minor are seen to co-migrate, as do ADH[D] major and
ADH[F] minor. These differences in the percentage of minor band
activity can affect calculations of ADH major form activity when
two or more alleles are assayed after electrophoresis in the same
lane.
*** DIN 2
DROSOPHILA INFORMATION NEWSLETTER
Volume 3, July 1991
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted, in unedited form, in the next issue of DIS.
Back issues of DIN are posted on the Indiana fileserver in the
directory fly/news. Material appearing in the Newsletter may be
cited unless specifically noted otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
many of your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
*** DIN 3
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail. If
you are on the list and do not wish to receive DIS, or you want
to remove a defunct address, replace SUB in the above message
with UNS. The SUB command can also be used to correct spelling
errors in your real name; the new entry will simply replace the
old as long as it was sent from the same USERID@NODE address.
*** DIN 3
DIN Vol. 3 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>E-mail directory of Drosophila workers
>Lefevre slides available
>Midwest regional Drosophila conference
>REQUESTS FOR MATERIALS
>Information for libraries list
>Clones for Drosophila genome project
>DATABASES/COMPUTING
>IUBIO - New FTP address for Drosophila information
>TECHNICAL NOTES
>Beta-gal activity in semithin epon sections
>Double-staining technique for discs
*** DIN 3
ANNOUNCEMENTS
E-MAIL ADDRESSES OF DROSOPHILA WORKERS
John Haynie established, maintains, and periodically
distributes a list of e-mail addresses of Drosophila workers. His
list formed the basis of the Newsletter distribution list, for
which the editors are ever grateful. If you would like to add
your name to his list, send a Bitnet message to John at
HAYNIE@GENESEO. When the next update of the list appears (any day
now) it will be posted on the Indiana fileserver in the directory
fly/news (see note from Don Gilbert, this issue).
*** DIN 3
LEFEVRE SLIDES AVAILABLE
All of the salivary gland polytene chromosome squashes used
by George Lefevre in the course of his radiation mutagenesis work
on the X chromosome must soon find a new home or be discarded. If
you are interested in having these slides, please contact Burke
Judd, N.I.E.H.S., P.O. Box 12233, Research Triangle Park, NC
27709. 919-541-4690; FAX/7953.
*** DIN 3
MIDWEST DROSOPHILA CONFERENCE
The Midwest regional meeting will be held October 11 and 12,
1991 at Allerton Park, IL. If you are not already on the mailing
list and would like information on the meeting, contact Hugh
Robertson, Dept. of Entomology, U. of Illinois, 505 S. Goodwin,
Urbana, IL 61801 (phone: 217-333-0489, FAX/244-3499.
HUGH_ROBERTSON@QMSL.LIFE.UIUC.EDU).
*** DIN 3
REQUESTS FOR MATERIALS
COMPILATION OF DROSOPHILA GENOMIC AND CDNA LIBRARIES.
Carl S. Thummel, HHMI, 5200 Eccles Institute, Bldg. 533, U. of
Utah, Salt Lake City, Utah, 84112, USA. 801-581-2937, FAX/5374,
THUMMEL@MEDSCHOOL.MED.UTAH.EDU.
Although a number of Drosophila genomic and cDNA libraries
have been constructed, one must depend on word-of-mouth and
publications to learn which libraries are currently available and
how useful they are for specific experimental purposes. I would
like to create a listing of all available Drosophila genomic and
cDNA libraries. This compilation should prevent the construction
of duplicate libraries as well as facilitate the isolation of
Drosophila genes.
This listing will include the following categories: genomic
(cosmid, phage) and cDNA (regular and expression). Please specify
which libraries you have available and send the following
additional information (preferably by Email or FAX).
1. Vector
2. Complexity (i.e. total number of clones that are present in
the library)
3. Titer (if known)
4. Source of DNA (Drosophila strain; also stage and tissues for
cDNA)
5. Your name, address, phone and FAX numbers
6. Any additional information that might be of use.
7. References (if any)
Since amplified phage libraries can be safely shipped by
regular mail, without wet or dry ice, the distribution of these
libraries should entail little expense. Thank you for your help.
This should be a valuable resource for the entire Drosophila
community.
*** DIN 3
REQUEST FOR CLONES
Leonard Rabinow[1] and Robert Saunders[2]. [1]Waksman Institute,
Rutgers Univ., Piscataway, NJ 08855-0759, USA. 908-932-0091/0092,
FAX/5735, RABINOW@BIOVAX. [2]Dept. of Biochemistry, Univ. of
Dundee, Dundee DD1 4HN, UK. (0382)23181 ext. 4790, FAX/201063,
BI31@UK.AC.DUNDEE.PRIMEB (reverse node order from USA).
Most readers of DIS are probably aware of a number of
projects in progress with the aim of constructing a physical map
of the Drosophila melanogaster genome. A collaboration among the
laboratories of F.C. Kafatos, C. Louis, C. Savakis, D.M. Glover,
and M. Ashburner is proceeding by fingerprinting cosmids selected
with cytological division-specific probes produced by
microdissection from polytene chromosomes (Nucl. Acids Res.
(1990) 18, 6261-6270). J. Messing, L. Rabinow, W. Sofer and G.
Hamm at the Waksman Institute, are initiating a project to
produce a restriction map of the genome, using bacteriophage P1
and automated reading of partial restriction digests.
Both projects will correlate their developing physical maps
with the genetic and cytological maps of Drosophila. To achieve
this, we would like to probe our libraries with loci cloned and
mapped by members of the Drosophila community. We would greatly
appreciate it if members of the fly community willing to
contribute clones would send them to either of the above
addresses. It would be most convenient if clones could be sent in
plasmids (preferably bearing T7, SP6 or T3 RNA polymerase
promoters), or M13, to avoid cross-hybridization problems. A few
micrograms of a specific oligonucleotide, if available, could
also be used. Submissions would be most useful if accompanied by
information on the name, identity, and location of the clone, its
vector, a restriction map or sequence, and a reference. To
coordinate the overall efforts, clones and data will be exchanged
among these groups. Submitted clones will be exchanged only
between these two groups, unless specifically authorized by the
sender.
*** DIN 3
DATABASES/COMPUTING
IUBIO - BIOLOGY ARCHIVE HAS A NEW ADDRESS
Don Gilbert, Dept. of Biology, Indiana Univ., Bloomington, IN
47405. 812-855-7807, FAX/6765, GILBERTD@IUBACS.
The IUBIO Archive of biology software and data is an
anonymous ftp archive that you will find on the computer with the
Internet name of FTP.BIO.INDIANA.EDU. This archive has been
located at the computer called IUBIO.BIO.INDIANA.EDU. The archive
has been moved temporarily to another computer, and will be
moving back to IUBIO and/or to other computer(s) as we upgrade
software and hardware. You should always be able to use the name
FTP.BIO.INDIANA.EDU to get to the current archive location. I
will also post location changes on the Bionet.software Internet
news group.
The FTP software on the current computer follows the Unix
standard, rather than the VMS syntax found at the previous
location of IUBIO. Remember that Unix is case sensitive. Please
let me know if you have problems with the new archive location.
This IUBIO Archive is on the Internet network of computers
with the name FTP.BIO.INDIANA.EDU. The actual host computer and
Internet number for this archive may change. The Internet address
of the current IUBIO archive computer is 129.79.224.50. Mail
about this archive or software on it may be directed to:
Archive@Bio.Indiana.Edu (preferred Internet address)
Gilbert@Cricket.Bio.Indiana.Edu (alternates if pref. is down)
Gilbertd@UCS.Indiana.Edu
Gilbertd@IUBACS.Bitnet
Access to IUBIO -- If your computer system is linked to the
Internet, it probably has an FTP program. Each FTP program has
it's own peculiarities, but most follow a general syntax:
ftp ftp.bio.indiana.edu -- connect to archive computer
user: anonymous
password: guest or your real user name (preferred)
? or help -- general help for ftp
cd subdirectory -- change to subdirectory (Unix)
cd .. -- change to superdirectory (Unix)
binary -- use full binary transfer
ascii -- use text transfer
get any.file -- fetch a file from the archive
put my.file -- put a file to the archive
(only for receive directory)
quit, bye -- close the connection
An abbreviated directory of the archive (Unix)
Archive.doc About this archive (this document)
Files Full list of archive files
Files.new Most recent archive files
biology/ General biology
chemistry/ Chemistry
fly/ Drosophila stocks and data
help/ Help documents
molbio/ Molecular biology
science/ General sciences
util/ Computer and archive utilities
./molbio:
align/ Sequence alignment
codon/ Codon tables
data/ Molecular data
evolve/ Evolution and phylogeny
ibmpc/ MSDOS software
mac/ Macintosh software
rnafold/ RNA secondary structure
search/ Databank searching
*** DIN 3
BOWLING GREEN STOCK CENTER STOCK LIST NOW AVAILABLE ON LINE
Ron Woodruff, Dept. of Biological Sciences, Bowling Green State
Univ., Bowling Green, OH 43403. 419-372-2631; FAX/2024;
WOODRUFF@BGSUOPIE.
The Bowling Green State University Mid-America Drosophila
melanogaster stock list Version 4/91 can be accessed through
Internet as follows:
FTP ANDY.BGSU.EDU
login: ANONYMOUS
password: OWN-USERID
cd pub
cd Drosophila
dir
get filename
quit
*** DIN 3
TECHNICAL NOTES
DEMONSTRATION OF BETA-GALACTOSIDASE ACTIVITY IN SEMITHIN EPON
SECTIONS OF DROSOPHILA
Simone Tix and Karl-Friedrich Fischbach. University Freiburg,
Biology III, Schaenzlestr. 1, 7800 Freiburg, Germany. Fax:
49-761-203-2745; E-mail: KFF@SUN1.RUF.UNI-FREIBURG.DE.
In our hands, the quality of studies of the expression of
lacZ reporter genes in frozen brain sections is mainly limited by
the poor tissue conservation. We have therefore developed a
method to demonstrate beta-galactosidase activity in
glutardialdehyde fixed semithin epon sections of larval, pupal
and adult brains counterstained with methylene
blue/borax/toluidin blue. The procedure was carried out as
follows:
Brains were dissected in 1 x PBS, fixed on ice for 30 min in 1%
glutardialdehyde in 1 x PBS, washed 3 x 5 min in 1 x PBS and
incubated at 37 oC over night in a staining solution containing
25 ul of 8% X-gal in DMSO per ml staining buffer (Simon et al.,
Cell 40, 805-817 (1985)). The next day, the objects were washed
again for 3 x 5 min with 1 x PBS and fixed for 1 h in 6.25%
glutardialdehyde in 1 x PBS at RT. They were then washed again 3
x 5 min in 1 x PBS and dehydrated (each step 10 min at RT, in
30%, 50%, 70%, 90% and 2 x in dried 100% ethanol). A 20 minute
incubation period in xylene (!) at RT followed. The brains were
transferred for 1 h into a 2:1 mixture of xylene and epon 812 at
RT and stored over night at 4 oC in a 1:1 mixture of xylene and
epon 812. Then the xylene was slowly evaporated for 6-10 h at RT
in the hood. The tissues were transferred into fresh epon and
stored over night in the fridge. The objects were embedded in
fresh epon the next day and polymerized for 12 h at 42 oC and 36
h at 65 oC. Semithin 2 um sections were cut on a Reichert-Jung
ultratome. The sections were baked over night on a hot plate at
60 oC and stained with a conventional mixture of 0.05% methylene
blue/0.05% borax/0.01% toluidin blue for not longer than 30 s at
60 oC. After washing off the excess stain with aqua dest. the
preparations were embedded with DEPEX (Serva).
In sections treated with this protocol it is easy to
distinguish the turquoise lacZ expressing cells from the
methylene blue/borax/toluidin blue stained cells in the
background. In our case, beta-galactosidase activity could even
be detected in the fine cytoplasmic lamellae of glial cells. It
is possible to discriminate many other cell types due to their
degree of counterstaining. The results are very much superior to
Pyronin G counterstaining, because the methylene blue/borax/
toluidin blue mix reveals many structural details of the lacZ-
negative tissue.
*** DIN 3
DOUBLE ANTIBODY STAINING OF IMAGINAL DISCS
Angela Pattatucci and Thom Kaufman, Dept. of Biology and HHMI,
Indiana University, Bloomington, IN 47405, USA. 812-855-7674,
FAX/2577, KAUFMAN@IUBACS.
Our protocol for fixation and staining of imaginal discs was
described in DIN Vol. 1. Two procedures for effective double-
staining of discs have been developed. The first method uses both
HRP- and AP-conjugated secondary antibodies and is superior for
staining cells at the surface of the disc, such as those of the
peripodial cell layer. If primary antibodies from different
sources (e.g., rabbit and mouse) are available, then carry out
the fixation and staining steps described in our previous note
through the washes that follow incubation of the tissue in DAB,
but include both primary antibodies in the primary incubation
mix, and use one HRP-conjugated and one AP-conjugated (we used
goat anti-rabbit AP from Boehringer Mannheim at 1:200) secondary
antibody in the secondary incubation mix. For primary antibodies
from the same source, the complete staining process must be
repeated in series for each primary antibody (always do the HRP
reaction first). The AP reaction mix consists of three parts
(adapted from Van Rooijen et al., 1984, J. Histochem. Cytochem.
32:677-681): Soln. 1 - 20 mg/ml naphthol AS phosphate (Sigma) in
N,N-dimethyl formamide; Soln. 2 - 60 mg/ml fast blue BB base
(Sigma) in 2N HCl, to which an equal volume of 4% NaNO[2] has
been added (filter by passing the soln. through a small cotton
plug in a pasteur pipet; Soln. 3 - 85 mM Tris (pH 9.8), 21 mM
MgCl[2], 11% DMSO, and 5 mM levamisole. Make the final reaction
mix by adding 25 ul of Soln. 1, then 50 ul of Soln. 2, to 3.66 ml
of Soln. 3. Incubate discs in the reaction mix in the dark for
about 30 min; stop the reaction by drawing off the staining
solution and washing the discs in several changes of PBS. DAB
produces a reddish-brown color, while fast blue BB base produces
a blue color. The two chromogens produce a deep-purple to black
color when present in the same cell (Boorsma, 1984,
Histochemistry 80:103-106).
The second method uses only HRP-conjugated secondaries and
works for cells at any position in the disc. This technique
adapts staining elements from Matthews et al. (1990, Dev. Biol.
137:171-183) and Graham et al. (1964, J. Histo. Chem. 13:150-
152). Follow the procedure previously described for fixation and
staining up to the final reaction mix for HRP. Add the following
reaction mix to the discs: 0.05% DAB in Tri-PBS, 0.07% NiCl[2],
0.003% H[2]O[2] (DAB-Ni produces a slate grey to blue color).
Monitor the reaction using a dissecting microscope and stop the
reaction with 0.1 vol of 5% NaAz. If the whole process must be
repeated (i.e., primaries are from the same source), incubate
discs for 2 hr in 0.5% NaAz in PBS to kill any remaining HRP
activity. Repeat the process but substitute this two part
staining reaction mix: Soln. 1 - 6 mg/ml 3-amino-9-ethylcarbazole
(AEC) in N,N-dimethyl formamide; Soln. 2 - 5% DMSO, 0.0075%
H[2]O[2] in 0.1M NaAc pH 5.2; add 50 ul of Soln. 1 to 950 ul of
Soln. 2. Incubate discs in this mixture until sufficient color
has developed, usually about 10 min. Stop the reaction by washing
the tissue in PBS. AEC produces a bright red color, while Ni-
DAB/AEC produces a brown to purple color depending on the
relative amounts of the two chromogens that have polymerized in a
given cell.
*** DIN 3
DROSOPHILA INFORMATION NEWSLETTER
Volume 4, October 1991
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted, in unedited form, in the next issue of DIS.
Back issues of DIN are posted on the Indiana fileserver in the
directory fly/news. Material appearing in the Newsletter may be
cited unless specifically noted otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
*** DIN 4
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail. If
you are on the list and do not wish to receive DIS, or you want
to remove a defunct address, replace SUB in the above message
with UNS. The SUB command can also be used to correct spelling
errors in your real name; the new entry will simply replace the
old as long as it was sent from the same USERID@NODE address.
*** DIN 4
IF YOU AREN'T RECEIVING THE NEWSLETTER: With each mailing of the
Newsletter, at least a dozen addresses are rejected by the
mailer. For many subscribers, I have no way of contacting you
except the e-mail address that isn't working. If you signed on to
the DIN distribution list and are not receiving the Newsletter,
please contact me so we can correct the problem. -- KM
*** DIN 4
DIN Vol. 4 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>Editor's note - rejected e-mail addresses
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>1992 Drosophila Conference
>Funding opportunity
>P-element insertion stocks
>New phone numbers at ICRF
>New phone numbers at UC Berkeley
>REQUESTS FOR MATERIALS
>Clones for Drosophila genome project
>Information for libraries list
>DATABASES/COMPUTING
>FLY.BIO.INDIANA.EDU - A new server for the fly community
>New release of Genetic Maps database
>Cytological features database
>TECHNICAL NOTES
>P element vectors for analyzing enhancer elements
>GENETIC NOTES
>Stocks for P-element mutagenesis
*** DIN 4
ANNOUNCEMENTS
1992 DROSOPHILA CONFERENCE. The 33rd Annual Drosophila Research
Conference will be held March 11-15, 1991 at the Wyndham Hotel,
Philadelphia, PA. The meeting organizer is Bill Gelbart,
Biological Labs, Harvard U., 16 Divinity Ave., Cambridge, MA
02138; 617-495-2906. The 1993 meeting will be held April 1-4,
1993, in San Diego, CA.
*** DIN 4
FUNDING OPPORTUNITY. The National Center for Human Genome
Research, NIH, is preparing a Request for Applications to solicit
applications to characterize the Drosophila melanogaster genome.
Research projects should focus on (1) the development of high-
resolution physical maps, (2) new technologies to detect all the
coding regions or expressed genes in the Drosophila genome, and
(3) feasibility studies for large-scale DNA sequencing using
regions of biological interest for pilot studies. Applicants may
request support for individual research projects, program
projects, feasibility/pilot projects, developmental grants, and
center grants.
The Request for Applications is expected to be announced
in late August in the NIH Guide to Grants and Contracts. The
application receipt date will be November 15, 1991. Applications
will be reviewed for scientific merit in February 1992 by the
NCHGR's Genome Research Review Committee and for programmatic
considerations by the National Advisory Committee on the Human
Genome in May 1992. The earliest award date will be July 1, 1992.
For further information contact Dr. Bettie J. Graham, Chief,
Research Grants Branch, National Center for Human Genome
Research, NIH, Bethesda, MD 20892, 301-496-7531, FAX/2770,
B2G@CU.NIH.GOV or @NIHCU.bitnet.
*** DIN 4
P-ELEMENT INSERTION STOCKS. The HHMI P-Element Stock Center
ceased to exist on August 1, 1990. HHMI provided two years of
funding for the creation of a collection of strains with single
P-element insertions with the understanding that maintenance and
distribution of the collection would be transferred to the NSF-
funded "regular" stock center at Bloomington at the end of the
HHMI funding period. The current collection of insertion stocks
at Bloomington consists of 1,152 P and 111 TE insertions. A site
of insertion has been reported for 685 of these stocks. P strains
collection by the HHMI stock center are listed in the file
PLIST.TXT on the Indiana file server; insertion stocks collected
post-HHMI are listed in the file NEWP.TXT (eventually data in
PLIST will be converted to the NEWP format). Stocks can be
ordered by contacting Kathy Matthews (812-855-5783).
*** DIN 4
NEW PHONE NUMBERS AT ICRF. On September 16th 1991, Phil Ingham's
and David Ish-Horowicz's telephone numbers will change following
the installation of Direct-Dialing at the ICRF Developmental
Biology Unit, Oxford. The new numbers will be: ICRF DBU
switchboard: (0)865 281300
FAX 281310
Phil Ingham 281323 (office)/ 281320 (lab)
David Ish-Horowicz 281306 (o) / 281305 (l)
*** DIN 4
NEW PHONE NUMBERS AT U.C. BERKELEY. The area code of all
University of California at Berkeley phone numbers has been
changed from 415 to 510.
*** DIN 4
REQUESTS FOR MATERIALS
REQUEST FOR CLONES
Leonard Rabinow[1] and Robert Saunders[2]. [1]Waksman Institute,
Rutgers Univ., Piscataway, NJ 08855-0759, USA. 908-932-0091/0092,
FAX/5735, RABINOW@BIOVAX. [2]Dept. of Biochemistry, Univ. of
Dundee, Dundee DD1 4HN, UK. (0382)23181 ext. 4790, FAX/201063,
BI31@UK.AC.DUNDEE.PRIMEB (reverse node order from USA).
Most readers of DIS are probably aware of a number of
projects in progress with the aim of constructing a physical map
of the Drosophila melanogaster genome. A collaboration among the
laboratories of F.C. Kafatos, C. Louis, C. Savakis, D.M. Glover,
and M. Ashburner is proceeding by fingerprinting cosmids selected
with cytological division-specific probes produced by
microdissection from polytene chromosomes (Nucl. Acids Res.
(1990) 18, 6261-6270). J. Messing, L. Rabinow, W. Sofer and G.
Hamm at the Waksman Institute, are initiating a project to
produce a restriction map of the genome, using bacteriophage P1
and automated reading of partial restriction digests.
Both projects will correlate their developing physical maps
with the genetic and cytological maps of Drosophila. To achieve
this, we would like to probe our libraries with loci cloned and
mapped by members of the Drosophila community. We would greatly
appreciate it if members of the fly community willing to
contribute clones would send them to either of the above
addresses. It would be most convenient if clones could be sent in
plasmids (preferably bearing T7, SP6 or T3 RNA polymerase
promoters), or M13, to avoid cross-hybridization problems. A few
micrograms of a specific oligonucleotide, if available, could
also be used. Submissions would be most useful if accompanied by
information on the name, identity, and location of the clone, its
vector, a restriction map or sequence, and a reference. To
coordinate the overall efforts, clones and data will be exchanged
among these groups. Submitted clones will be exchanged only
between these two groups, unless specifically authorized by the
sender.
*** DIN 4
COMPILATION OF DROSOPHILA GENOMIC AND CDNA LIBRARIES
Carl S. Thummel, HHMI, 5200 Eccles Institute, Bldg. 533, U. of
Utah, Salt Lake City, Utah, 84112, USA. 801-581-2937, FAX/5374,
THUMMEL@MEDSCHOOL.MED.UTAH.EDU.
Although a number of Drosophila genomic and cDNA libraries
have been constructed, one must depend on word-of-mouth and
publications to learn which libraries are currently available and
how useful they are for specific experimental purposes. I would
like to create a listing of all available Drosophila genomic and
cDNA libraries. This compilation should prevent the construction
of duplicate libraries as well as facilitate the isolation of
Drosophila genes.
This listing will include the following categories: genomic
(cosmid, phage) and cDNA (regular and expression). Please specify
which libraries you have available and send the following
additional information (preferably by Email or FAX).
1. Vector
2. Complexity (i.e. total number of clones that are present in
the library)
3. Titer (if known)
4. Source of DNA (Drosophila strain; also stage and tissues for
cDNA)
5. Your name, address, phone and FAX numbers
6. Any additional information that might be of use.
7. References (if any)
Since amplified phage libraries can be safely shipped by
regular mail, without wet or dry ice, the distribution of these
libraries should entail little expense. Thank you for your help.
This should be a valuable resource for the entire Drosophila
community.
*** DIN 4
DATABASES/COMPUTING
FLY.BIO.INDIANA.EDU - A NEW SERVER FOR THE FLY COMMUNITY
Kathy Matthews, Indiana Drosophila Stock Center, Dept. of
Biology, Indiana U., Bloomington, IN 47405, USA. 812-855-5792,
FAX/2577, MATTHEWK@UCS.INDIANA.EDU or @IUBACS.
Through the Bloomington stock center, NSF's Division of
Instrumentation and Resources has provided the funds for the
purchase of a Sun Sparcstation 2 to function as the fly
community's database server. Once Drosophila data have been
transferred to this machine, you will automatically reach
FLY.BIO.INDIANA.EDU (129.79.224.25) when you ftp to
FTP.BIO.INDIANA.EDU. Don Gilbert will continue to maintain the
public server on this new machine and will be helping us develop
on line search capabilities for this system. With 1.2 GB of
storage, the space crunch we were experiencing with IUBIO will
not be a FLY problem for the foreseeable future. If you have a
database in electronic format that would be of interest to the
Drosophila community please consider posting it on FLY.
*** DIN 4
NEW RELEASE OF GENETIC MAPS DATABASE
Michael Ashburner, Dept. of Genetics, U. of Cambridge, Downing
St., England CB2 3EH. 44-223-333969, FAX/333992,
MA11@PHX.CAM.AC.UK.
A new version of the Drosophila Genetic Maps (Version 9107,
27 July 1991) database has now been released. Information on
obtaining it is given below. Note that this is the first version
of the database to include genetic aberration data. Problems to
Michael Ashburner.
Obtaining the database:
The database can be obtained electronically from three sources:
the archive fileserver at the Dept. of Biology, Indiana U.,
Bloomington, IN and the Netserver at EMBL, Heidelberg. In
addition these files are also available on the SEQNET facility to
registered users within the United Kingdom. I am very grateful to
Don Gilbert at Indiana, Rainer Fuchs at EMBL and Alan Bleasby at
Daresbury for making this database available in these ways.
The files are:
GENES AND MAPS:
o MAINDOC.TEXT - General documentation (this file)
o FUNCTIONDOC.TEXT - Documentation of FUNCTION file
o LOCIDOC.TEXT - Documentation of LOCI file
o MAPDOC.TEXT - Documentation of MAPLOCI file
o SYNONYMDOC.TEXT - Documentation of SYNONYM file
o REFSDOC.TEXT - Documentation of REFS file
o FUNCTION.TEXT - Genes sorted by function
o LOCI.TEXT - Genes sorted by gene symbols
o MAPLOCI.TEXT - Genes sorted by genetic map
position
o SYNONYMS.TEXT - Table of synonyms of gene symbols
o REFS.TEXT - References
ABERRATIONS:
o ABDOC.TEXT - Documentation for the following
tables
o ABAS.TEXT - Table of autosynaptic elements
o ABDF.TEXT - Table of deletions
o ABDP.TEXT - Table of duplications
o ABIN.TEXT - Table of inversions
o ABI.TEXT - Table of insertions
o ABT.TEXT - Table of translocations
o ABTP.TEXT - Table of transpositions
o ABREF.TEXT - References for these tables
From Indiana:
The files are kept on FTP.BIO.INDIANA.EDU and are accessible by
FTP (File Transfer Protocol). The files are in the directory
fly/loci. To obtain any of these files use the following
commands:
>ftp ftp.bio.indiana.edu
ftp> user: anonymous
ftp> password: guest
ftp> cd fly/loci
ftp> get DOC.TEXT
ftp> get LOCI.TEXT
... et cetera
... or
ftp> mget *.TEXT (to retrieve all TEXT files)
ftp> bye
The numeric address of FTP.BIO is 129.79.224.50 (this will change
to 129.79.224.25 in the near future), in case your nameserver is
as archaic as some. If you do not have the facility for FTP, it
is possible to use an interface between BITNET and TCP/IP at
Princeton University (see below).
From EMBL: These files are available from the Netserver at EMBL,
and if you do not have the facility for FTP this is the way to
get them (but see below). For HELP send an e-mail message to
NETSERV@EMBL.BITNET with the text HELP DROSOPHILA. For a listing
of the files on the EMBL Netserver send the message DIR
DROSOPHILA. To obtain a particular file send an e-mail message
with the text GET FILENAME to NETSERV@EMBL.BITNET, where FILENAME
is one of the filenames listed above.
From SEQNET: The SERC SEQNET computing facility at the Daresbury
Laboratory is available to researchers in the United Kingdom.
This computer (UK.AC.DL.DLVH) can be directly accessed via JANET.
For an account write to Dr. Alan Bleasby, SERC Daresbury
Laboratory, Warrington WA4 4AD, Cheshire or send e-mail to
AJB@UK.AC.DARESBURY.DLVH. These files are kept in a directory
called DATA1:[DROSOPHILA].
Via BITFTP@PUCC: For those without access to FTP there is a
gateway between BINET/EARN and the FTP part of TCP/IP at
Princeton. This allows you to make an FTP request by BITNET/EARN
mail, the file(s) requested from the remote site being forwarded
to you as mail from Princeton. This gateway is known as BITFTP.
For information on how you use it send the one-line message HELP
to BITFTP@PUCC.BITNET. In brief, this service is used by sending
a MAIL message (using BITNET) to BITFTP@PUCC as follows:
FTP ftp.bio.indiana.edu NETDATA
USER anonymous guest
<now the FTP commands as if you were doing this directly; see
above> QUIT
The files will then be returned to you by mail.
*** DIN 4
CYTOLOGICAL FEATURES DATABASE
Sally Amero, Dept. of Molecular and Cellular Biochemistry, Loyola
University Medical Center, 2160 South First Ave., Maywood, IL
60153, USA. 708-216-3365, FAX/8523, and Michael Ashburner, Dept.
of Genetics, U. of Cambridge, Downing St., England CB2 3EH.
44-223-333969, FAX/333992, MA11@PHX.CAM.AC.UK.
The Cytological Features Database, Version 9108, is a
database of polytene chromosome sites that have been found to
bind antibodies to particular Drosophila proteins. The database
is maintained by Sally Amero and has been formatted by Michael
Ashburner. The formatted form of the database is available from
the Indiana server in the directory fly (see previous article for
server access). Direct comments, additions or corrections to
Sally Amero.
The format is as follows:
line 1 - cytological position [field 1]/gene name [field 11]/
protein name [field 31]/antibody [field 51]
line 2 - comments [if any] [field 11]
lines 3 on - references [field 11]
It should be quite easy for you to resort this database on
another field, e.g. that of the gene. Should you want this and be
unable to do it then send an e-mail message to M.A. If there is
the demand then the database can be distributed in versions
sorted on fields other than cytological location. Sally Amero's
original database includes salivary gland puff sites. These have
not been included here, but can be made available on demand to
Michael Ashburner.
*** DIN 4
TECHNICAL NOTES
P ELEMENT VECTORS FOR ANALYZING ENHANCER ELEMENTS
Keith Wharton, Molecular Biology Institute, Room 306, U. of
California, Los Angeles, CA 90024-1570, USA. 213-206-3184,
FAX/7286.
Three P element vectors have been constructed that contain a
weak promoter fused to coding sequences for a nuclear
localization signal and a lacZ reporter gene. These constructs
are all in the pCaSpeR vector, allowing the selection of
transformants using the white minigene. A variety of unique
restriction sites are available upstream from the lacZ gene,
facilitating the insertion of enhancer sequences - CPLZ: SphI,
BamHI, EcoRI; CPLZN: SphI, BamHI, NotI; C4PLZ: SphI, BamHI, SpeI,
SfiI, NotI, SstII, KpnI, EcoRI. The effects of these sequences
can then be monitored in the intact animal, by examining nuclear
beta-galactosidase expression. DNA, restriction maps, and more
information are available upon request.
*** DIN 4
GENETIC NOTES
USEFUL STOCKS FOR P-ELEMENT MUTAGENESIS
Kathy Matthews, Indiana Drosophila Stock Center, Dept. of
Biology, Indiana University, Bloomington, IN 47405, USA. 812-855-
5782/FAX 2577; MATTHEWK@UCS.INDIANA.EDU or @IUBACS.
A variety of stocks useful for P-element mutagenesis are
available from the Bloomington stock center. New and/or most
widely useful lines are listed below, beginning with the stock
number.
Ammunition chromosomes
#2538 Birm2; ry[506] (Birm2 carries 17 unmarked P elements)
#2539 Birm2; TM6/Sb
#P20 y w P{w[+]-lacW}3-76a
#3697 C(1)RM, y P{w[+]-lacW}5-45fD w P{w[+]-lacW}4-5fP
P{w[+]-lacW}3-52d P{w[+]-lacW}3-76a/+/Y
#3709 y P{w[+]-lacW}5-45fD w P{w[+]-lacW}4-5fP P{w[+]-lacW}3-52d
P{w[+]-lacW}3-76a
#3710 O/C(1;Y), y P{w[+]-lacW}5-45fD w P{w[+]-lacW}4-5fP
P{w[+]-lacW}3-52d P{w[+]-lacW}3-76a y[+]/C(1)RM, y pn
#3711 C(1)RM, y P{w[+]-lacW}5-45fD w P{w[+]-lacW}4-5fP
P{w[+]-lacW}3-52d P{w[+]-lacW}3-76a/w[1118]/Y
Sources of transposase
#406 Dr/TMS, Sb P{ry[+]-delta2-3}99B (TMS = MKRS +
In(3R)87A-B;97F-98A)
#1610 w; Dr/TMS, Sb P{ry[+]-delta2-3}99B
#1798 w; ry[506] Sb P{ry[+]-delta2-3}99B/TM6B
#2383 TM2, ry P{ry[+]-delta2-3}/TMS, Sb P{ry[+]-delta2-3}
#2534 ry[506] P{ry[+]-delta2-3}99B
#2535 CyO/Sp; ry[506] Sb P{ry[+]-delta2-3}99B/TM6, Ubx
#2536 w; ry[506] P{ry[+]-delta2-3}99B
#2540 C(1)DX, y f; ry[506] P{ry[+]-delta2-3}99B
#3612 w; Sp/CyO; ry[506] P{ry[+]-delta2-3} Dr/TM6
#3629 w; Sp/CyO; ry[506] Sb P{ry[+]-delta2-3}99B/TM6B
#3664 y w; ry[506] Sb P{ry[+]-delta2-3}/TM6
#3712 T(Y;3)TMS, Sb P{ry[+]-delta2-3}99B/+
References: #2534-2536, #2538-2540, Robertson et al., 1988,
Genetics 118:461; #P20, #3709, Bier et al., 1989, Genes & Devel.
3:1273.
*** DIN 4
DROSOPHILA INFORMATION NEWSLETTER
Volume 5, January 1992
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted, in unedited form, in the next issue of DIS.
Back issues of DIN are posted on the Indiana fileserver in the
directory fly/news. Material appearing in the Newsletter may be
cited unless specifically noted otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
***
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail. If
you are on the list and do not wish to receive DIN, or you want
to remove a defunct address, replace SUB in the above message
with UNS. The SUB command can also be used to correct spelling
errors in your real name; the new entry will simply replace the
old as long as it was sent from the same USERID@NODE address.
*** DIN 5
DIN Vol. 5 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>1992 Drosophila Conference
>1992 Meeting of the Drosophila Board
>DIS 71
>Gordon Conference on meiosis
>Postdoctoral positions in Drosophila genetics
>New phone numbers at Johns Hopkins and Carnegie Institution
>The Council on Undergraduate Research
>REQUESTS FOR MATERIALS
>Information for libraries list
>DATABASES/COMPUTING
>Drosophila database on the network
>TECHNICAL NOTES
>Injecting through the chorion
*** DIN 5
ANNOUNCEMENTS
1992 DROSOPHILA CONFERENCE. The 33rd Annual Drosophila Research
Conference will be held March 11-15, 1991 at the Wyndham Hotel,
Philadelphia, PA. The meeting organizer is Bill Gelbart. Advance
registration deadline is January 27, 1992. For registration
information contact the Genetics Society of America at 301-571-
1825.
*** DIN 5
1992 MEETING OF THE DROSOPHILA BOARD. The Drosophila Board will
meet on March 11 in Philadelphia. If you have concerns about the
annual conference, DIS, DIN, operation of the board itself, or
other issues that you would like brought before the board,
contact your representative before the meeting. See DIS 70 or DIN
2 for the name and address of your current representative.
*** DIN 5
DIS 71. Drosophila Information Service 71, to be published July
1992, will contain: stock lists, directory of Drosophila
researchers, relevant material from DIN 1-5, technique notes,
research notes, and new mutant reports. If you have material to
submit, please do so as soon as possible to: Drosophila
Information Service, c/o James N. Thompson, jr., Dept. of
Zoology, U. of Oklahoma, Norman, OK 73019, USA. Material will be
accepted until the issue is full, but no later than 1 April 1992.
See DIS 70:108 for a guide to authors. There is a modest page
charge for halftones and for long articles. Order forms can be
obtained from the above address. Price is $12.00 plus shipping
($3.00 for USA surface, $6.00 for foreign surface; see order form
for various foreign air mail shipping charges). All orders must
be accompanied by a check in U.S. currency drawn on a U.S. bank.
*** DIN 5
MEIOSIS - A NEW GORDON RESEARCH CONFERENCE. July 12-17, 1992;
Plymouth State College; Plymouth, New Hampshire, USA. This
meeting will emphasize presentation of recent results on the
nature of meiosis with a view towards integration of classical
and molecular observations. Talks on important aspects of meiosis
will be included. The meeting will be structured so as to
encourage discussion and the consideration of new paradigms for
thinking about these problems.
TOPICS: Mechanisms of and relationships among chromosome
pairing, synaptonemal complex formation and recombination;
chromosome structure and condensation; roles of topoisomerases;
mechanistic approaches to a genome-wide homology search;
chiasmata and pairing sites; three dimensional array of
chromosomes; cell cycle checkpoints at and after pachytene;
control of recombination and chromosome pairing; moving
chromosomes with motor proteins; attaching chromosomes to the
spindle; sister chromatid adhesion; entry into meiosis and
meiotic gene expression; human disorders of meiosis; and the
evolutionary importance of recombination.
SPEAKERS: B. Byers, D. Camerini-Otero, A. Campell, D.
Dawson, R.E. Esposito, L. Goldstein, T. Hassold, R.S. Hawley, C.
Heyting, P. Hieter, G. Jones, N. Kleckner, A. Mitchell, K.
Mizuuchi, H. Nash, A. Nicolas, B. Nicklas, T. Orr-Weaver, D.
Perkins, P. Pukkila, C. Rieder, S. Roeder, S. Rasmussen, J.-L.
Rossignol, J. Sedat, D. Sherratt, G. Simchen, F. Stahl, E.
Taylor, W. Therkauf, M. Yamamoto, D. Zickler.
TO REGISTER: See the March 6 issue of Science magazine.
ORGANIZERS: Dr. R. Scott Hawley, Dept. of Genetics, U. of
California, Davis, CA, USA; Dr. Gareth Jones, Dept. of Genetics,
University of Birmingham, Edgbaston, Birmingham B15 2TT, UK;
Dr. Nancy Kleckner, Dept. of Biochem. and Molecular Biology,
Harvard U., Cambridge, MA, USA; Dr. Gloria Simchen, Dept. of
Genetics, Hebrew U., Jerusalem, Israel.
*** DIN 5
POSTDOCTORAL POSITIONS IN DROSOPHILA GENETICS.
1) Available February 1, 1992 or thereafter to study dosage-
sensitive regulators of the white eye color gene. Send curriculum
vitae and the names of three references to: Dr. James A.
Birchler, Division of Biological Sciences, 117 Tucker Hall, U. of
Missouri, Columbia, MO 65211.
2) Available immediately, to study P element transposition
and its accompanying DNA gap repair. See article by Gloor et al.,
Science 253:1110 (1991) for more details. Send resume and
references to: Dr. William R. Engels, U. of Wisconsin, Genetics
Dept., Madison, WI 53706, or E-mail to:
WRENGELS@VMS.MACC.WISC.EDU.
*** DIN 5
NEW PHONE NUMBERS AT JOHNS HOPKINS AND CARNEGIE INSTITUTION. As
of November 1, 1991, the area code for Johns Hopkins and the
Carnegie was changed from 301 to 410. The following fly labs have
the 410 area code: Beachy, Corces, Fyrberg, Montell, Shearn,
Spradling. In addition, the exchange was changed from 338 to 516
for Shearn, Fyrberg, and Corces.
*** DIN 5
THE COUNCIL ON UNDERGRADUATE RESEARCH. The mission of the Council
on Undergraduate Research (CUR) is to promote science and
mathematics research at primarily undergraduate institutions. Key
elements of this mission include working with federal agencies,
corporations and foundations to develop programs which support
research in the undergraduate environment and, through our
newsletter, conferences and directories, disseminating
information about funding sources, grant proposal development,
and ideas for developing and supporting a successful
undergraduate research program.
The specific goals of CUR include: --Increasing the quantity
and quality of student-faculty research in science and
mathematics at primarily undergraduate institutions --Increasing
the understanding and awareness nationwide of research done at
undergraduate institutions --Strengthening the integration of
research with teaching.
Presently, CUR members can join one of six disciplinary
councils including the Biology Council. If you support the goals
of CUR and would like to become a member, contact John Stevens,
National Executive Officer, The Council on Undergraduate
Research, University of North Carolina at Ashville, Ashville, NC
28804-3299; phone: 704-251-6006.
*** DIN 5
REQUESTS FOR MATERIALS
COMPILATION OF DROSOPHILA GENOMIC AND CDNA LIBRARIES
Carl S. Thummel, HHMI, 5200 Eccles Institute, Bldg. 533, U. of
Utah, Salt Lake City, Utah, 84112, USA. 801-581-2937, FAX/5374,
THUMMEL@MEDSCHOOL.MED.UTAH.EDU.
This request has been published in the last two issues of
DIN, for 6 months, and I have received only two responses. This
effort will not work unless you help. Your effort now will save
many people both time and effort in their work (and perhaps even
help you someday!). Please take a few minutes NOW to read this
request and send me your library information.
Although a number of Drosophila genomic and cDNA libraries
have been constructed, one must depend on word-of-mouth and
publications to learn which libraries are currently available and
how useful they are for specific experimental purposes. I would
like to create a listing of all available Drosophila genomic and
cDNA libraries. This compilation should prevent the construction
of duplicate libraries as well as facilitate the isolation of
Drosophila genes.
This listing will include the following categories: genomic
(cosmid, phage) and cDNA (regular and expression). Please specify
which libraries you have available and send the following
additional information (preferably by Email or FAX).
1. Vector and site of insertion
2. Complexity (i.e. total number of clones that are present in
the library)
3. Source of DNA (Drosophila strain; also stage and tissues for
cDNA)
4. Your name, address, phone and FAX numbers, and Email address
5. Any additional information that might be of use.
6. References (if any)
Since amplified phage libraries can be safely shipped by
regular mail, without wet or dry ice, the distribution of these
libraries should entail little expense. Thank you for your help.
This should be a valuable resource for the entire Drosophila
community.
*** DIN 5
DATABASES/COMPUTING
DROSOPHILA DATABASE ON THE NETWORK
Kathy Matthews, Indiana Drosophila Stock Center, Dept. of
Biology, Indiana U., Bloomington, IN 47405, USA. 812-855-5792,
FAX/2577, MATTHEWK@UCS.INDIANA.EDU or @IUBACS.
The set of flat files that currently constitute the free-
access Drosophila community database are now posted on the file
server FLY.BIO.INDIANA.EDU (129.79.224.25) as part of Don
Gilbert's Archive for Biology. Unless noted otherwise, the files
are located in the subdirectory fly. Currently available files
include Michael Ashburner's genetic map and chromosome aberration
lists and a list of cosmids that have been localized to the
cytological map (these files are in fly/loci), John Merriam's
Genevent summary file (showing the cytological locations of
cloned DNA, rearrangement breakpoints, and transposable element
insertions (called clonelist.txt), Sally Amero's cytological
features file which lists polytene sites known to bind antibodies
to particular proteins (called amero.txt), John Haynie's
directory of Drosophila workers' e-mail addresses, stock lists
from the Bloomington and Bowling Green stock centers, and back
issues of DIN (in fly/news). If you have a database that would be
useful to others, please consider posting it on FLY.
The server can be reached as follows:
ftp FTP.BIO.INDIANA.EDU (or FLY.BIO.INDIANA.EDU; by using
FTP.BIO.INDIANA.EDU, you will reach the
database even if it has temporarily been
moved to another machine)
user: anonymous
password: your e-mail address
cd fly (or fly/loci, fly/news; must be lower case)
dir (to see a list of files)
get filename (to copy files individually)
or
mget *.txt (or *.doc or *.* to copy multiple files;
respond yes to the files you want copied)
bye (or quit, to log off)
Some things to remember: you must use ftp, not telnet, to
access the server. Spaces count - if a space is shown above, be
sure you include it. FLY is a Unix, so case is important.
Commands shown in lower case must be typed in lower case, and
file names must be typed as they appear in the directory. The
directory path to your current location is implied when using "cd
fly" to move down in the directory. When moving back up the
directory hierarchy, you must add a "/". For example, to move
from fly/loci to fly, type "cd /fly"; to move back to the archive
root, type "cd /".
*** DIN 5
TECHNICAL NOTES
INJECTING THROUGH THE CHORION - A REMINDER
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405, USA. 812-855-5792, FAX/2577, MATTHEWK@UCS.INDIANA.EDU or
@IUBACS.
From discussions of P-element transformation with a variety
of people using the stock center, it appears that quite a few
labs are not aware that embryos can be successfully injected
without dechorionation. This simplified method was reported by
Robertson et al., Genetics 118:461-470 (1988), with thanks to Ed
Korn for developing the technique. Since intact embryos don't
require desiccation before injecting, the dessication step is
deleted as well as the dechorionation process. In addition to the
time saved, stress on the embryos is reduced. The only
modification we made to adapt our injection technique to this
method was to shorten the taper of our needles to prevent flexing
and breaking as they are forced through the chorion.
*** DIN 5
DROSOPHILA INFORMATION NEWSLETTER
Volume 6, April 1992
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted in DIS. Back issues of DIN are posted on the
Indiana fileserver in the directory fly/news. Material appearing
in the Newsletter may be cited unless specifically noted
otherwise.
Material for publication may be submitted in any of the
following formats - Macintosh Microsoft Word or MacWrite, MS-DOS
WordPerfect, or text/ASCII file. Figures and photographs cannot
be accepted at present. Send material, in order of preference, as
E-mail (addresses below), on floppy disk, or as laserwriter or
typed hard-copy (not bit-mapped). Technical notes should be sent
to Carl Thummel, all other material should be sent to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
*** DIN 6
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail. If you are
on the list and do not wish to receive DIN, or you want to remove
a defunct address, replace SUB in the above message with UNS. The
SUB command can also be used to correct spelling errors in your
real name; the new entry will simply replace the old as long as
it was sent from the same USERID@NODE address.
*** DIN 6
DIN Vol. 6 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>DIS 71
>13th European Drosophila Research Conference
>Drosophila Population Biology meeting
>Gordon Conference on meiosis
>Postdoctoral positions
>Bloomington stock center summer schedule
>COMMENTARY
>Annual Drosophila meeting format
>REQUESTS FOR MATERIALS
>Natural orcein
>Survival data
>DATABASES/COMPUTING
>Drosophila database on the network
>TECHNICAL NOTES
>An improved proboscis extension assay
>GENETIC NOTES
>New lac-z-marked balancer
*** DIN 6
DIS 71. Drosophila Information Service 71, to be published July
1992, will contain: stock lists, directory of Drosophila
researchers, relevant material from DIN 1-5, technique notes,
research notes, and new mutant reports. To obtain an order form
write to: Drosophila Information Service, c/o James N. Thompson,
jr., Dept. of Zoology, U. of Oklahoma, Norman, OK 73019, USA.
Price is $12.00 plus shipping ($3.00 for USA surface, $6.00 for
foreign surface; see order form for various foreign air mail
shipping charges). All orders must be accompanied by a check in
U.S. currency drawn on a U.S. bank.
*** DIN 6
13th EUROPEAN DROSOPHILA RESEARCH CONFERENCE.
Dear Colleague, It may come as a surprise to you to find the
first circular of the 13th EDRC in your mailbox some 20 months
before it takes place, but the organizing committee felt that it
would be necessary to contact you as soon as possible. As you may
already have heard, our Swiss colleagues had to give up their
plans to organize the next EDRC, due to unforseen and unsolvable
organizational problems at the University of Zuerich. The Crete
laboratory was asked whether it could take over, and we agreed.
The 13th EDRC is, thus, scheduled for September 12-17, 1993 in
Crete.
Since the month of September is still high season on the
island, it is extremely difficult for us, at this time, to let
you know the exact location of the Conference. We are trying our
best to find accommodation for the constantly rising number of
European drosophilists and also to guarantee low prices for rooms
in a place that will be conveniently close to an airport. This
requires long searching and a lot of bargaining on our side. We
understand that scientists would like to keep their freedom of
scheduling their attendance until the very last moment but these
circumstances make it mandatory for us to plan a long way ahead.
Therefore, in our next circular, which will be mailed fall 1992,
we will ask for a preregistration, i.e. a more or less final
decision as to whether you would like to attend, and whether you
would want us to book hotel rooms for you. After the final
registration deadline in February or March 1993 we will no longer
be in a position to offer any help with lodging and you will be
on your own. Bear in mind, though, that during last year most of
the hotels in Crete were overbooked until the beginning of
November.
Finally, you will also have noticed that the Conference will
last one day longer than usual. This means that there will be
more opportunities for oral presentations. Although, again, no
final commitments will be required we would welcome your
preferences in this matter (poster or oral presentation) soon
after the second circular has been received by you. For more
information please contact:
13th European Drosophila Research Conference
c/o Dr. K. Louis
Insect Molecular Genetics Group
Institute of Molecular Biology and Biotechnology
P.O.Box 1527, GR-711 10 Heraklion, Crete, Greece
fax: 0030-81-231308
E-mail: FLIES@GRIMBB or FLIES@MYIA.IMBB.FORTH.GR
*** DIN 6
DROSOPHILA POPULATION BIOLOGY MEETING, to be held Monday 21 to
Thursday 24 September 1992, Leeds University, Yorkshire, UK.
This meeting, organized by the Drosophila Population Biology Unit
(Professor Bryan Shorrocks) will cover wild Drosophila
populations and their interactions with the environment. For
further details contact the organizer Dr. Andrew Davis
PAB6AWD@UK.AC.Leeds.CMS1 (or fax +44 532 332909).
*** DIN 6
MEIOSIS - A NEW GORDON RESEARCH CONFERENCE. July 12-17, 1992;
Plymouth State College; Plymouth, New Hampshire, USA. This
meeting will emphasize presentation of recent results on the
nature of meiosis with a view towards integration of classical
and molecular observations. See DIN Vol. 5 and the March 6 issue
of Science magazine for further information.
*** DIN 6
POSTDOCTORAL POSITIONS AVAILABLE
1) A postdoctoral position is available immediately to study
chromosomal inheritance at the Salk Institute. One project will
focus on the identification, isolation and study of the
centromere, and other chromosomal elements, essential to the
meiotic and mitotic inheritance of a Drosophila minichromosome
(Dp(1;f)1187). Our research will capitalize on the molecular and
genetical tools generated during studies of the centromeric
heterochromatin of Dp(1;f)1187 (Karpen and Spradling, Cell 63:97
(1990)). A second project will utilize the genetic properties of
Dp(1;f)1187 to identify gene products that interact in trans with
the centromere to promote transmission. By studying both
the cis and trans components essential to inheritance of this
minichromosome, we expect to gain a better understanding of the
structure of the centromere and the kinetochore, as well as the
molecular basis for interaction between these components.
Practical applications of these studies include the development
of a minichromosome vector for the analysis of chromosomal
functions and large genes in Drosophila and other higher
eukaryotes.
The Salk Institute in general, and the Molecular Biology and
Virology Laboratory in particular, provide an excellent
environment for scientific research. The atmosphere is congenial,
and dedicated to the pursuit of a wide variety of biological
questions. The climate of La Jolla and San Diego, and the
numerous opportunities for pursuing outdoors activities, make
this an ideal setting in which one can integrate hard work and
relaxing play. Candidates should send a resume and three
references to: Dr. Gary Karpen, MBVL, The Salk Institute, 10010
North Torrey Pines Road, La Jolla, CA 92037 (phone 619-453-4100
ext. 473), or E-mail to: KARPEN@SALK-SCI.SDSC.EDU (internet) or
KARPEN@SALK.BITNET (bitnet).
2) A postdoctoral position is available immediately to study
developmental neurobiology of the visual system and the molecular
mechanisms that guide axons to their targets and that induce the
brain to develop. Projects combine molecular biology, genetics
and cell biology emphasizing gene expression at both the
transcript and protein level in situ. Conventional light
microscopes, optical sectioning microscopes (laser confocal and
deconvolution), and electron microscopes are all available. Send
curriculum vitae and references to: Dr. John A. Pollock,
Carnegie Mellon Univ., Dept. of Biological Sciences, 4400 Fifth
Avenue, Pittsburgh PA 15213; E-Mail jp4o@andrew.cmu.edu.
3) Available immediately: Postdoctoral position to study the
genetic structure and behavior of the Responder (Rsp) locus in
the 2R centromeric heterochromatin of D. melanogaster, including
transformation with Rsp DNA repeats and assessment of
dose/response relationship between DNA repeat number and
sensitivity to sperm dysfunction induced by the Segregation
distorter (SD) locus. (See Lyttle article in Ann. Rev. Gen.
(1991) volume 25). Send letter of application and three letters
of reference to: Terrence W. Lyttle, A102 Biomedical Sciences
Bldg., Dept. of Genetics and Molecular Biology, Univ. of Hawaii,
Honolulu, HI 96822, FAX 808 956 5506, e-mail LYTTLE@UHCCVX or
TLYTTLE@UHUNIX.UHCC.HAWAII.EDU.
4) Available April 1, 1992, or thereafter to work on the
genetics and evolution of male genital morphology in Drosophila
using enhancer trap screening and P element transformation.
Experience with Drosophila genetics and molecular biology is
desirable. Please request additional information or send cv,
brief description of research experience and three letters of
reference to: Dr. Cathy C. Laurie, Dept. of Zoology, Duke U.,
Durham, NC 27706.
*** DIN 6
BLOOMINGTON STOCK CENTER SUMMER SCHEDULE
The Bloomington stock center will be closed the week of July
5. Orders received after 12 noon Hoosier time (CDST) on July 2
will be processed the week of the 12th for shipment July 20.
*** DIN 6
COMMENTARY
ARE THE ANNUAL DROSOPHILA RESEARCH MEETINGS GETTING TOO BIG?
Frank M. Butterworth, Oakland U., Rochester, MI.
BUTTERWO@VELA.ACS.OAKLAND.EDU.
Yes. They are not only too big, but also they are too
expensive. My recommendation is to limit the size either by
having a registration cut-off number or limiting the number of
attendees from a given lab, OR having several simultaneous
meetings with maybe only 4-5 specific topics instead of 10-15.
Maybe you'll have to do all three. If you have to have concurrent
sessions, the meeting is still too big. They should be given in
cheaper places such as university campuses which rent out their
facilities in the summer. There is absolutely no reason why we
have to put so much financial stress on underfunded scientists
and students.
For the past decade the meetings have slowly but inexorably
become more populous and are slowly losing their ability to do
what they're supposed to: namely to provide an EFFECTIVE vehicle
for the EFFICIENT exchange of information. At the risk of
sounding condescending, meetings to be EFFECTIVE AND EFFICIENT
must be limited in size - limited numbers of plenary talks with
NO concurrent sessions, limited costs, limited numbers of
attendees, and limited space. These limitations would keep people
in close proximity during meals and coffee breaks and assure
plenty of time for people to meet as many others as they wish and
plenty of time for leisurely discussion.
It is a lot of work to host and plan a meeting, and I think
the makers and shakers of the "fly society" are doing a great job
(thanks folks!), but at the same time are losing track of things.
We all know what makes a good meeting, but I feel our leaders
need some feedback from us followers. After all aren't we the
ones who make you leaders?
The fly meetings are popular because they are good. However
they WERE great! Now I feel they have reached the point where
they no longer perform their intended function. If small meetings
are good, why are big meetings bad? Because they are incredible
time wasters. At the last ASCB meeting I attended, I spent at
least fifty percent of my time going somewhere, trying to get to
a concurrent session, trying to find someone, trying to make
reservations for dinner, traveling around in cabs and shuttle
buses. Next time you're at a large meeting stop for a moment and
watch. What do you see? Weary people by the hundreds walking back
and forth, almost aimlessly. Not talking science, but walking!
Walking is good, but this is ridiculous. Big meetings also create
information overload. In one day you can get enough to saturate
your scientific curiosity receptors. In two days you're reduced
to the ranks of the aimless walkers. I will bet that if you can
set up a science exchange efficiency quotient (SEEQ) you'd find
that big meetings will get a low score, small meetings will get a
high score. Its time to limit the annual meeting size. Thanks for
reading this. I hope in the next DIN we get more dialogue on this
topic.
[Editors' note: More discussion of this issue is welcome.
However, the people who make decisions about meeting formats are
the members of the Drosophila board. Your opinion about the
annual meeting should be conveyed to your regional representative
to the board. See DIN Vol. 2 or DIS 70 for the name and address
of your representative.]
*** DIN 6
REQUESTS FOR MATERIALS
NATURAL ORCEIN
Michael Ashburner, Dept. of Genetics, U. of Cambridge, Downing
St., Cambridge CB2 3EJ, England. 44-223-333969, FAX/333992,
MA11@PHX.CAM.AC.UK.
Does anyone know a source for Natural Orcein? Gurr's (that is
BDH) now only stock synthetic. If you let me know directly then I
will broadcast the information in the next issue of the
Newsletter. Thank you.
*** DIN 6
SURVIVAL DATA
Matthew Witten, UT System Center For High Performance Computing,
Balcones Research Center, 1.154 CMS, 10100 Burnet Rd., Austin, TX
78758-4497, USA. 512-471-2472, FAX/2445 or 2449,
M.WITTEN@HERMES.CHPC.UTEXAS.EDU or M.WITTEN@UTCHPC.BITNET.
I am actively involved in a long term project on the
analysis of survival data. Many people use Drosophila and keep
survival distributions under various experimental conditions. I
am collecting multispecies datasets on survival of all species
and would welcome receipt of reprints/preprints/actual data. We
have an electronic submission system SURVIVAL@CHP.UTEXAS.EDU or
SURVIVAL@HERMES.CHPC.UTEXAS.EDU. If you have any questions,
please contact me.
*** DIN 6
DATABASES/COMPUTING
INTERNET GOPHER - A BETTER WAY TO GET FLY INFO
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405, USA. 812-855-5792, FAX/2577, MATTHEWK@UCS.INDIANA.EDU or
@IUBACS.
Don Gilbert has added Gopher to the Bloomington server's
repertoire. Internet Gopher software was developed at the
University of Minnesota to provide a fast and simple means of
distributing information over the network. Using Gopher Client
software running on your local machine, you can easily access
information from other computers running Gopher Server software.
Gopher presents a self-explanatory GUI (graphical user interface)
that allows you to retrieve whole text files or to search files
that have been indexed for Gopher's use.
Gopher Client software is available by anonymous ftp to
boombox.micro.umn.edu in the directory pub/gopher. This directory
has a readme file and 11 subdirectories; type "dir" to see the
list, then move into the subdirectory that is relevant for your
machine with "cd subdirname". You must type the subdirectory name
exactly as it appears in the list; Mac_client will not be found
if you type mac_client or Mac-client. Gopher is available for PC,
Mac, VMS, CMS, Unix, and NeXT platforms. Copy the relevant files
to your local machine with the command "get filename". If you
want to move back to the top of the directory, type "cd /". Type
"bye" or "quit" to log off when you are through. You will
probably need to have someone with experience at configuring
network software install the Gopher Client on your machine.
IUBio Archive Gopher allows you to retrieve any of the
Drosophila-related text files through the menu-driven GUI. In
addition, the stock lists (both Bloomington and Bowling Green)
can be searched for keywords. At present, keyword searching of
the stock lists is not as robust as we would like. Don will be
reeducating Gopher in the near future to make it more useful for
Drosophila nomenclature. In the meantime, the following might
help you make use of the search feature.
Gopher was designed to find whole words in text; it ignores
punctuation such as parentheses and brackets, and it cannot
accept wild-cards. Thus, if Gopher is asked to search for the
string "Df(3R)by62", it finds all deficiency stocks, all 3R
rearrangements, and all stocks with the string by62, and returns
a list of the first 50. A short list of only the desired stocks
can be identified using only "by62" as the keyword. Searches can
be done on gene symbols or superscripts of two or more letters,
but not on gene symbol-superscript combinations (genotypes in the
stock lists enclose superscripts in square brackets; Gopher
ignores the brackets and searches for the gene symbol and
superscript separately, usually resulting in a very long list).
For example, asking for "Antp[73b]" produces a long list of all
of the stocks containing any Antp allele and anything else with
the string 73b, while searching for "73b" finds only stocks with
Antp[73b] or revertant alleles. A search for breakpoints must
cover all possible band numbers until Don adds wild-cards to
Gopher. As it stands now, to find all rearrangements and inserts
in 85D you will have to do 15 separate queries - 085D, 085D01,
085D02, etc. through 085D14 (the zeros are a by-product of the
DBM used at Bloomington - for stocks to sort properly by
breakpoint all segment numbers must be three digits, and all band
numbers must be two digits). You will probably find it easier to
copy the sorted files for individual rearrangements (Df.txt,
Dp.txt, In.txt, and T_Tp.txt) and transposon insertions
(P_by_loc.txt and newP_by_loc.txt) from the server (you can do
this through Gopher) and simply look at the file on your local
machine, scrolling down to the cytological region of interest.
To reach the fly server without Gopher:
ftp ftp.bio.indiana.edu (or fly.bio.indiana.edu, or
129.79.224.25)
user: anonymous
password: your e-mail address
cd fly (or fly/flybase, fly/news; cd / to the root)
dir (to see a list of files and subdirectories)
get filename (to copy files individually)
or
mget *.txt (or *.doc or *.* to copy multiple files;
respond yes to the files you want copied)
bye (or quit, to log off)
Remember: Don't use instructions from old issues of DIN;
some aspects of server access have changed significantly. You
must use ftp, not telnet, to access the server. Spaces and case
count - type commands exactly as shown, and type file names
exactly as they appear in the directory.
*** DIN 6
TECHNICAL NOTES
AN IMPROVED PROBOSCIS EXTENSION ASSAY
Eva Cheng, Chungming Chang, and Y. Henry Sun, Institute of
Molecular Biology, Academia Sinica, Nankang Taipei 11529, Taiwan,
Rep. of China. FAX: 886-2-782-6085, YHSUN%IMB@TWNAS886.BITNET.
Flies extend their proboscis in response to a sugar solution
applied to the tarsal or labellar taste hairs. This proboscis
extension reflex has been extensively used as an assay for
gustatory response. In conventional methods, the fly is bound by
wax or myristic acid (Tompkins, L. & Barnhart, K. J., 1982, DIS
58: 171-172), the test solution is then applied to the tarsi or
labella by cotton-tipped applicator. An alternative method is to
mount the fly into a plastic micropipet tip with the head and
first pair of legs protruding out of the tip bore (Vargo, M. &
Hirsch, J., 1982, DIS 58: 174). Both methods are tedious and
slow, unsuitable for large-scale mutant screens. In addition, the
flies are being tested under strain, which may affect their
response. We have developed a method for testing the proboscis
extension reflex in free-walking flies.
A 1.5% agarose solution containing test sugar is boiled and
cooled to 50-60oC. A 1 ml plastic pipet is cut to 10 cm length.
The sugar-agarose solution is sucked up from one end to 4.5 cm
high and then expelled. From the other end of the pipet, a 1.5%
agarose solution is sucked up to 4.5 cm high and also expelled.
A thin agarose coating is thus left along the inner surface of
the pipet, with the blank agarose and sugar-agarose on opposite
ends, separated by 1 cm to prevent mixing. At the blank agarose
end, a plastic 1000 ul pipet tip (blue tip) is attached, with the
tip cut to an opening of 2-3 mm in diameter to allow the fly to
pass through. A starved and water-satiated fly is introduced into
the test pipet through the blue tip. The pipet is then raised to
a vertical position and an optic fiber illuminator is positioned
above the pipet. The fly is induced to walk upward by negative
geotaxis and positive phototaxis. The first section of blank
agarose probably accustoms the fly to the agarose coating. When a
wild type fly steps onto the sugar-agarose section, its proboscis
extends repeatedly. The response can be easily observed without a
microscope. This assay is simple, rapid, and the flies are
recovered intact. About 60-100 flies can be tested per hour,
making large scale mutant screening feasible. Using this assay,
we have isolated several mutants with a defective response to
sucrose. It is also possible to sequentially suck up agarose
solutions with increasing concentrations of sugar, creating
partially overlapping layers. This allows the response threshhold
to be determined in a single run. This research was supported by
grant NSC-78-0203-B001-11 from the National Science Council, ROC.
*** DIN 6
GENETIC NOTES
NEW LAC-Z MARKED BALANCER
Scott Panzer, Alison Fong, and Steve Beckendorf, MCB:Genetics, U.
of California, Berkeley, CA 94720, USA. 510-642-6973, FAX/7000;
SPANZER@ENZYME.BERKELEY.EDU.
We constructed a new lac-Z marked balancer by jumping a
P{eve-lacZ} onto SM6B, Cy Roi. Because eve-directed beta-gal
synthesis starts in blastoderm embryos, embryos carrying the
balancer may be distinguished histochemically from those that
don't at many stages of development. (In contrast, the other lacZ
marked second chromosome balancer we've come across, CyO-beta
P{elav-lacZ}, is most useful only in embryos older than seven
hours old). Flies and more information available upon request
directly from us (send request by email if possible) or from the
Bloomington stock center.
*** DIN 6
DROSOPHILA INFORMATION NEWSLETTER
Volume 7, July 1992
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted in DIS. Back issues of DIN are posted on the
Indiana fileserver in the directory fly/news. Material appearing
in the Newsletter may be cited unless specifically noted
otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@IUBACS.BITNET
THUMMEL@MEDSCHOOL.MED.UTAH.EDU MATTHEWK@UCS.INDIANA.EDU
*** DIN 7
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail. If you are
on the list and do not wish to receive DIN, or you want to remove
a defunct address, replace SUB in the above message with UNS. The
SUB command can also be used to correct spelling errors in your
real name; the new entry will simply replace the old as long as
it was sent from the same USERID@NODE address.
*** DIN 7
DIN Vol. 7 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Educating non-population geneticists
>Population biology meeting
>Enhancer-trap stocks available
>REQUESTS FOR MATERIALS
>Old Redbook sought
>Updates/corrections to new Redbook
>Natural orcein
>DATABASES/COMPUTING
>Morphological mutants database
*** DIN 7
AN OPEN LETTER FROM JAMES CROW: There is a growing concern
among population geneticists regarding their communications with
non-population geneticists, a problem which is perceived to
affect the process of reviewing research grant applications. An
ad hoc committee has been formed to prepare a series of mini-
reviews that set forth the strengths and accomplishments of the
various subjects and methods in population genetics. This is seen
as a useful exercise for those in the field, as well as providing
information for outsiders who must form judgements about research
projects.
The effort is being coordinated by Bruce Weir; other members
of the committee are Francisco Ayala, Allan Campbell, Brian
Charlesworth, Michael Clegg, Marcus Feldman, Daniel Hartl, Mary
Claire King, Martin Krietman, Charles Langley, Richard Lewontin,
Glenys Thomson, and Bruce Walsh. For information on submitting
material for these reviews before the July 31, 1992 deadline,
please contact: Dr. Bruce Weir, Dept. of Statistics, North
Carolina State U., Raleigh, NC 27695-8203, (919)515-3574,
FAX/7591.
*** DIN 7
DROSOPHILA POPULATION BIOLOGY MEETING, to be held Monday 21 to
Thursday 24 September 1992, Leeds University, Yorkshire, UK.
This meeting, organized by the Drosophila Population Biology Unit
(Professor Bryan Shorrocks) will cover wild Drosophila
populations and their interactions with the environment. For
further details contact the organizer Dr. Andrew Davis
PAB6AWD@UK.AC.Leeds.CMS1 (or fax +44 532 332909).
*** DIN 7
ENHANCER-TRAP STOCKS AVAILABLE
Dan Lindsley has made a set of 232 enhancer-trap stocks
carrying autosomal mini-w[+] inserts (Bier et al., Genes & Dev.
3:1273) available through the Bloomington stock center. The
stocks were generated by undergraduate students and are a random
set (i.e., nothing has been removed based on phenotype). 84 lines
(42 on 2, 42 on 3) express lacz in the testis. Of the remaining
148 lines, 80 have inserts on 2 and 68 have inserts on 3. These
stocks will be maintained by the stock center for a limited time.
If you are interested in screening these lines you should plan to
obtain them from the stock center within the next 18 months.
*** DIN 7
REQUESTS FOR MATERIALS
REDBOOK WANTED
Roger J. Harris, Dept. Biology, U. of Oregon, Eugene, OR 97403,
USA. 503-346-5090, FAX/2364, RJHARRIS@OREGON.UOREGON.EDU.
I would like to purchase a used copy of "Genetic variations
of Drosophila melanogaster" by Lindsley & Grell (1968), Carnegie
Institute Publications No. 627. I will pay any reasonable price.
If your lab has a spare copy please contact me.
*** DIN 7
UPDATES AND CORRECTIONS TO THE REDBOOK
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405. 812-855-5782, FAX/2577, MATTHEWK@UCS.INDIANA.EDU.
As you probably know, the new Redbook, "The Genome of
Drosophila melanogaster" by Dan Lindsley and Georgianna Zimm,
Academic Press, San Diego, is now available (call 1-800-321-5068
to order directly from the publisher). Dan and Georgianna have
done an admirable job. The book is a pleasure to use, and all of
our scientific lives are made easier by having access to the vast
amount of information it contains. Producing this volume was a
hugh task and future compilations will be increasingly difficult.
Dan and Georgianna have passed the curatorial torch on to Michael
Ashburner who, for reasons unknowable, is willing to perform this
vital service to our community. Nevertheless, Michael cannot do
it alone. We as individuals need to take an active role in
updating information in our fields of expertise. With the hope of
making that a bit easier, I am asking that you submit
new/updated/corrected Redbook information to me by e-mail
(only!). I will post your information on the stock center file
server where it will be available to Michael and the rest of us
as well. Corrections, new mutations, and other appropriate
information that you provide will also be published in DIN.
*** DIN 7
NATURAL ORCEIN
Michael Ashburner, Dept. of Genetics, U. of Cambridge, Downing
St., Cambridge CB2 3EJ, England. 44-223-333969, FAX/333992,
MA11@PHX.CAM.AC.UK.
Does anyone know a source for Natural Orcein? Gurr's (that is
BDH) now only stock synthetic. If you let me know directly then I
will broadcast the information in the next issue of the
Newsletter. Thank you.
*** DIN 7
DATABASES/COMPUTING
MORPHOLOGICAL MUTANTS OF DROSOPHILA MELANOGASTER: A PRELIMINARY
DATABASE FROM THE `RED BOOK'
Roger J. Harris, Dept. of Biology, U. of Oregon, Eugene OR
97403-1210, USA. 503-346-5090, FAX/2364,
RJHARRIS@OREGON.UOREGON.EDU.
Lindsley and Grell's (1972) `Genetic variations of
Drosophila melanogaster', also known as the `Red Book', is a
unique tool for geneticists. Besides 3000 or so mutants there are
lists for chromosome aberrations, special chromosomes and other
genetic variants from a `wild-type' genotype. The mutation data
is listed by code, name, location, origin, discoverer,
references, phenotype and cytology. The salivary chromosome
drawings and accompanying gene map enable the worker to quickly
locate a mutant phenotype to a particular chromosomal region.
Recently, the `Red Book' has been updated (by Lindsley and
Zimm) so the information now includes data since 1972 (Brutlag,
pers. comm.). This was recently published as `The Genome of
Drosophila melanogaster' and is also available as a draft in
recent special DIS issues. The new book is available from the
publishers or as text files from GenBank, but as it is free text
it is inaccessible for computer surveys. A detailed appendix does
not exist (Ashburner, pers. comm.). To classify mutations by
effects on particular traits, it is necessary to go through each
description that lists phenotypic effects. To do this with the
free text would be extremely tedious, so I coded the data to make
computer searches more efficient.
Towards this aim, I put all the data on 1016 mutations that
affect morphology into a database much smaller than that of the
free text. This article is to announce the completion of
preliminary work on the database. Work remains but the database
is available for use by others (details below).
Compilation of data into the database: First, I got the
updated `Red Book' by file transfer from GenBank via a VAX
mainframe computer. Mutations that affect morphology were entered
into the database. I used the MSExcel spreadsheet on a Macintosh
microcomputer. The information in the database format is much
easier to access and manipulate than the free text.
The data for each mutation is entered in the same order as
in the `Red Book': gene code, gene name, chromosome, position,
origin, phenotype and cytology. I included only mutations that
affect adult external morphology, so many details in the GenBank
data are omitted. Mutations that affect internal adult structures
are excluded, as are behavioral, biochemical and embryonic
mutants and mutations which influence the expression of other
mutations, such as those at suppressor loci. For brevity, alleles
beside the first listed in the `Red Book' are also omitted from
the database. This will be a problem for investigations of
pleiotropic effects or if mutations for specific experimental
purposes are needed. I should emphasize the database will be
expanded. The effects for alleles other than the first listed, as
well as other omitted data are in separate databases that are
incomplete at the time of writing.
Some mutations in the original `Red Book' are not listed in
the new version because they were found to be part of a gene
complex and so were subsumed under the name of the complex (e.g.,
scute is now listed under ASC, achaete-scute complex, rather than
sc). In my database, I included the mutations from the first book
and noted to which complex they belonged. The corresponding
variant listed under the complex is cross-referenced. For
example, the entry for the `allele' scute at the ASC complex is
under scute and not ASC, but the scute entry notes it is a part
of the ASC complex.
The important difference between my database and the free
text is that the phenotypic effects of the mutations are coded.
This was to lessen the amount of memory occupied by the data. The
total amount of memory occupied is 181K, whereas the original
listing needs 4.2 MBytes (S. Maulik, pers. comm.). The coding
speeds up data entry and forces the reduction of descriptions to
a minimum. Thus there are no synonymous or redundant terms in the
code. There are a total of 149 different effects listed. Single
effect descriptors are reduced to three letters by use of the
first three consonants (e.g., white is `wht'). This was to have a
code which was shorter than the word itself, yet still
intuitively meaningful. I did not use a numerical code because of
the latter condition.
The body parts affected by the mutations were coded with
four letters and numbers. Table 1 lists the major body part
groups. The list of all coded morphological structures is too
large to include here but all those pictured in the fly drawings
in Lindsley and Grell (1972: 472) are used in the database.
The aim for coding the body parts was to have a hierarchical
structure to the code. The body part affected is the first letter
of the code which is always upper case. The second letter is the
trait group which the mutation affects. The third and fourth
letters (the fourth position may be a number) are unique
identifiers for a particular body part. For example, "Wv15" is
the fifth (5) longitudinal (1) wing (W) vein (v). Mutational
effects on different body segments are separated by a solidus (/)
and trait groups within a segment, by a comma. Multiple effects
on the same trait are separated by a comma.
Here is a typical example of an entry. The entry for the
effects of the mutation bowed: "W bwd dwn, sml/B sml/E blg". Note
that the part affected is listed first, the result of the
mutation second. The wings (W) are bowed (bwd) down (dwn) and
smaller (sml) than normal. The body (B) size is reduced (sml) and
the eyes are bulging (blg).
There is also a `Notes' column which is for data on
viability, fertility and development time. This column may
include information about other phenomena which may influence
expression such as gene interaction and temperature effects. For
bowed these are: "OL/V 75%", which means the mutant phenotype
overlaps (OL) the wild-type and that viability (V) is 75% of the
wild-type.
Use of the database: While the code was established I
compiled a dictionary. This allows mutations to be studied for
particular phenotypic effects. For example, if I wanted to know
which mutations caused pink eyes, I would look up `pink' in the
dictionary and find the code "pnk", then do a computer search for
the string, "pnk". With this, it is possible to quickly find
mutants at different loci with similar phenotypic effects. The
converse dictionary can be used to look up any code for the right
description.
With the dictionary the data can be quickly searched for
information on specific effects, body parts affected or important
effects on fitness. My immediate aim is to update Braver's (1956)
list of mutations by body parts affected. With the database I can
construct a list with a more detailed hierarchy of parts affected
and greatly expand the original list.
Limitations of the data set: There are some limitations
that arise from the way the data is structured. The effects are
not listed separately if there are multiple effects on the same
trait. In the above example, if I wanted to search for mutations
that cause smaller wings, the search string "W sml" would not
have found bowed. Instead one would have to use the string ",sml"
(comma included) and then omit entries which did not have W
preceding sml. This flaw in the database can be amended by adding
the trait code before the effect code. In the example, this would
give "W bwd dwn, W sml/B sml/E blg". This would increase the
amount of memory taken but simplify searches for entries with a
particular code. I will incorporate this modification into a
second version of the database.
A more basic limitation is the loss of information necessary
to streamline the database. As noted above, for brevity I omitted
descriptions of alleles beside the one first listed in the `Red
Book'. This is usually the first allele found at a locus. Certain
non-morphological effects of listed alleles are not in the list.
Variation in description is also lost. For example, quantitative
differences of allelic effects are excluded, so a description of
small wings will be "W sml" whether the effect is strong or weak.
Improvements could be made to the biological basis of the
database structure. For example, the hierarchical groups of
traits are arbitrary and for convenience. Thus, mutations that
affect eyes are in a separate group from those that affect other
head structures, even though eyes are part of the head. So the
hierarchical groups do not correspond to imaginal discs or
homeotic segments, although it should be easy in principle to
modify the database accordingly.
These shortcomings may be important in some applications but
I think the database will be useful for studies which need a
general survey of morphological mutational effects.
Availability: To obtain the database send a MacIntosh
formatted 3 1/2-inch floppy disk (DD) to the author with return
postage. The database will soon be available as a text file by
anonymous FTP. The data will include the dictionaries as well as
the listing of mutations.
Acknowledgements: I thank Kathy Matthews and I. L. Heisler
for helpful comments on the manuscript.
Table 1. List of major body parts listed in the `Red Book'
database. The list below does not include the specific structures
within body parts, (e.g., orbital bristles on head) which are in
the database.
Body part: head, antenna, eyes, thorax, legs, wings, abdomen,
cuticle, body, bristles, hairs.
Non-morphological traits: lethality, viability, fertility,
development, sterility.
*** DIN 7
DROSOPHILA INFORMATION NEWSLETTER
Volume 8, October 1992
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
for publication in DIS. Materials appearing in the Newsletter
will be reprinted in DIS. Back issues of DIN are posted on the
Indiana fileserver in the directory fly/news. Material appearing
in the Newsletter may be cited unless specifically noted
otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 8
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail if you have
successfully signed on to the list. If you are on the list and do
not wish to receive DIN, or you want to remove a defunct address,
replace SUB in the above message with UNS. The SUB command can
also be used to correct spelling errors in your real name; the
new entry will simply replace the old as long as it was sent from
the same USERID@NODE address.
*** DIN 8
DIN Vol. 8 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>hb stocks available
>REQUESTS FOR MATERIALS
>Wild-type strains from northern latitudes
>Unstable ring X
>Natural orcein
>DATABASES/COMPUTING
>Umea stock list
>New release of Cytological Features Database
>GENETIC NOTES
>Updates and corrections to the Redbook
>TECHNICAL NOTES
>Immunostaining of polytene chromosomes
>Modified ppac plasmid for transient expression of
proteins in transfected tissue culture cells
>Plasmid vectors for expressing proteins in tissue culture
cells or studying enhancer function
*** DIN 8
The Bloomington Stock Center is currently maintaining a
large collection of hb alleles or related material. We will be
eliminating the majority of these stocks from the collection in
the near future. If you would like to receive any of the stocks
listed below you should order them as soon as possible, but no
later than December 1, 1992.
3137 Dp(3;4;Y)Rg-pbxV, p[p]/p[p]; Dp(3;1)68, y[2]/FM6
1751 hb[2-16] rsd/TM3
1750 hb[2-4] rsd/TM3
1752 hb[5-1] rsd/TM3
1756 hb[Rg-pbx-rv1]/TM1
1757 hb[Rg-pbx-rv2]/TM1
1758 hb[Rg-pbx-rv3]/TM1
2399 In(3R)hb[D]/T(2;3)ap[Xa]
3038 l(3)85A-V1/TM3 (potential deletion)
3039 l(3)85A-V8/TM3 (potential deletion)
2400 Rg-pbx[+RE1]/TM3
3045 Rg-pbx[+RE2]/TM3
3049 Rg-pbx[+RE4]/TM3
3050 Rg-pbx[+RE5]/TM3
3041 Rg-pbx[+RE6] ca e[s]/TM3
3048 Rg-pbx[+RE7]/TM3
3051 Rg-pbx[+RE8]/TM3
3047 Rg-pbx[+RE9]/TM3
3046 Rg-pbx[+RG2]/TM3
3040 Rg-pbx[+RX1] ca e[s]/TM6B
1743 Rg-pbx[b16] rsd/TM3
1741 Rg-pbx[b2] rsd/TM6B
1745 Rg-pbx[b50] rsd/TM6B
1747 Rg-pbx[e21] Ki red e/TM3
1737 Rg-pbx[pr1-4] p roe/TM6B
1759 T(Y;3;4)P96, Rg-pbx/red cv-c sbd
*** DIN 8
REQUESTS FOR MATERIALS
WILD STRAINS OF DROSOPHILA MELANOGASTER
John Ringo, Dept. Zoology, U. of Maine, Orono, ME 04469, USA.
207-581-2556, FAX/2537, RINGO@MAINE.
I am seeking wild strains of Drosophila melanogaster captured
above the 45th parallel. The higher the latitude the better. I
hope to obtain strains from a wide range of geographic locations.
Both flies and information about whom to contact directly for
flies will be deeply appreciated.
*** DIN 8
UNSTABLE RING X
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405, USA. 812-855-5782, FAX/2577, MATTHEWK@INDIANA.EDU.
The Bloomington Stock Center would like to have a line of
R(1)2, w[vC] that is sufficiently unstable to provide a useful
number of mosaics, but not so unstable that it is extremely
difficult to maintain. If you have such a line, please call me.
*** DIN 8
NATURAL ORCEIN
Michael Ashburner, Dept. of Genetics, U. of Cambridge, Downing
St., Cambridge CB2 3EJ, England. 44-223-333969, FAX/333992,
MA11@PHX.CAM.AC.UK.
Does anyone know a source for Natural Orcein? Gurr's (that
is BDH) now only stock synthetic. If you let me know directly
then I will broadcast the information in the next issue of the
Newsletter. Thank you.
*** DIN 8
DATABASES/COMPUTING
EUROPEAN STOCK CENTER AT UMEA STOCK LIST
An electronic version of the European Drosophila Stock
Center's 1991-1992 stock list is now posted on the Indiana file
server in the file Umea.txt.
*** DIN 8
CYTOLOGICAL FEATURES DATABASE, VERSION 9207
Sally Amero, Dept. of Molecular and Cellular Biochemistry, Loyola
U. Medical Center, 2160 South First Ave., Maywood, IL 60153.
708-216-3365, FAX/8523, YM60SAA@luccpua.bitnet.
This is a database of polytene chromosome sites that have
been found to bind antibodies to particular Drosophila proteins.
The database is maintained by Sally Amero and has been formatted
by Michael Ashburner. It is available by anonymous ftp from the
Indiana fileserver (ftp.bio.indiana.edu) in the directory fly.
The database is kept in two files: Amero.txt is the database
itself and Amero.Refs are the references for the database. The
file Amero.doc contains information about the organization of
Amero.txt.
*** DIN 8
GENETIC NOTES
UPDATES AND CORRECTIONS TO THE REDBOOK
(Editor's note: if you have similar corrections/updates to the
Redbook, please send them to KM. A cumulative file of these
corrections will be posted on the Indiana fileserver.)
(1) mhc, myosin heavy chain -- The draft entry on mhc, published
in DIN, volume 68, is accurate, but the entry in the final
version of the "Genome of Drosophila melanogaster" includes an
appended exon diagram of mhc, page 459, that incorrectly labels
the five alternative exons 11's. In our primary publication
describing the complete structure of mhc, George, et al. Mol.
Cell Biol. 9, 2957-2974 (1989), we designated the order of these
exons (5' to 3') to be 11e, 11a, 11b, 11c, 11d. (The diagram on
page 459 incorrectly orders these exons 11a, 11b, 11c, 11d, 11e).
-- Charles Emerson, emerson@castor.rm.fccc.edu
(2) Khc, kinesin heavy chain -- The symbol for the kinesin heavy
chain gene, shown on p. 296 as Kin, is Khc. -- Bill Saxton
(3) p. 638: "shaven: see svb" should read "shaven: see sv"
(4) p. 109: add entry "cel, cell lethal: see l(3)84Ab" -- Ken
Howard
(5) p. 259: add entry "grh, grainy-head: see Ntf" -- Larry Marsh
*** DIN 8
TECHNICAL NOTES
IMMUNOSTAINING OF POLYTENE CHROMOSOMES
Daniele Zink and Renato Paro, ZMBH, University of Heidelberg, Im
Neuenheimer Feld 282, D-6900 Heidelberg, Germany.
49-6221-566878, FAX/565891, bsa210@cvx12.inet.dkfz-heidelberg.de
Many people have contacted us regarding our protocol for
immunostaining of polytene chromosomes. Our current protocol is
listed below, in its entirety. We hope that this will be of use
to others who are interested in identifying protein binding sites
in the polytene chromosomes.
1. Preparation of 3rd instar larvae: Use bottles with rich
medium (i.e. 8 g agar, 18 g dried yeast, 10 g soybean meal, 7 g
molasses, 80 g malt extract, 80 g cornmeal and 6.3 ml propionic
acid in 1 lt water). Add a large drop of live baker's yeast on
top of the dried medium. Let the flies lay eggs to the point
where larvae will hatch under uncrowded conditions (< 100
larvae/bottle) and grow larvae at 18[o]C. For salivary gland
preparations, use crawling 3rd instar larvae.
2. Chromosome squashes: Dissect two pairs of salivary glands
in solution 1. Try to get rid of most of the fat body without
separating the two glands. Using a tungsten needle with a hook,
transfer the glands to a drop of solution 2 on a siliconized
coverslip. Fix the glands homogeneously by moving them with the
tungsten needle for 10-30 sec in solution 2 (time needs to be
adjusted for each individual antigen). Move glands into a droplet
(40 ul) of solution 3 on a coverslip (Corning or equivalent
quality, 22x22 mm, not siliconized) and leave them for 2 - 3 min.
During this incubation, break up the glands and get rid of
remaining chitinous structures of the pharynx using tungsten
needles. Lower a poly-L-lysine treated slide onto the coverslip.
Under the stereo-microscope, tap the coverslip with a pencil
until cells are broken up. Hold the coverslip and spread the
chromosomes using the eraser-end of the pencil. Remove excess
fixative by pressing slides (coverslip down) onto blotting paper.
Examine the preparation under phase contrast. Mark the position
of the coverslip. After freezing slides in liquid nitrogen, flick
off coverslip with a razor blade. Wash slides two times for 15
min. in PBS, slowly shaking the rack. Proceed with the
immunostaining or keep the slides (up to one week) in 100%
methanol or in 50% (w/v) ammonium sulfate at 4[o]C.
3. Immunostaining: Stored slides are washed 2 x 15 min. in
PBS. Block for 1 hour in blocking solution at room temperature
(rt). Add 40 ul affinity-purified primary antibodies (i.e. rabbit
polyclonal antibodies; try dilutions in the range from 1:50 to
1:500 in blocking solution) to each slide. Cover with coverslip
and incubate for 1 h at rt in a humid chamber. Rinse in PBS.
Wash: 15 min in PBS, 300mM NaCl, 0.2% NP40, 0.2% Tween20-80; then
15 min in PBS, 400mM NaCl, 0.2% NP40, 0.2% Tween20-80. If
background problems persist, NaCl conc. can be raised to 500mM.
Shake rack thoroughly during washing. Rinse in PBS. Add 40 ul
diluted secondary antibody (i.e. anti-rabbit IgG (Fc) HRP-
conjugate, Promega cat.# W4011, 1:100 dilution) with 2% normal
(goat) serum in blocking solution. Cover with coverslip and
incubate for 40 min. at rt in humid chamber. Rinse in PBS. Wash
exactly as described above for the primary antibody. Rinse in
PBS. Add 100 ul 0.5 mg/ml DAB-solution (diaminobenzidine
tetrachloride; Sigma # D5637) + 0.01% H[2]O[2] (Merck # 7210).
Watch the color develop under phase contrast. Stop reaction by
dipping slides in PBS. Wash 10 min. in PBS.
4. Cytology: Stain chromosomes for 10-20 sec. in Giemsa
solution (Merck # 9204; 1:130 dilution in 10 mM sodium phosphate
buffer pH 6.8). Rinse in distilled water. Mount in 99.5% glycerol
and immediately examine the slides under the microscope - the
giemsa stain fades within a few hours. Chromosomes can be washed
in PBS and restained. For storage, slides can be frozen at
-20[o]C. Entelan (EM Science) can be used as a permanent mounting
solution. In order to increase the contrast between the signals
and the chromomeres (important for black and white photography)
DAB precipitates can be enhanced by applying a silver
amplification system (Amersham). The enhancement is performed
according to the manufacturer's protocol, except that the silver
amplification step is shortened to about 1 min.
Solutions and reagents:
Solution 1: 0.1% Triton X-100 in PBS pH 7.5.
Solution 2: 3.7% formaldehyde, 1% Triton X-100, in PBS pH 7.5.
The 37% formaldehyde stock solution used to make this solution is
prepared as follows: 1.85g paraformaldehyde dissolved in 5 ml
water, add 70 ul 1 N KOH, dissolve by boiling).
Solution 3: 3.7% formaldehyde, 50% acetic acid.
Important: Solutions 2 and 3 should be made fresh every 2 - 3
hours! Blocking solution: 3% BSA, 10% non-fat dry milk, 0.2%
NP40, 0.2% Tween20-80 in PBS. Do not worry about the turbidness
of the solution. It still works!
Preparation of Poly-L-lysine coated slides for chromosome
squashes: Start with 100 - 200 slides in racks. Soak slides in a
corrosive detergent solution for 2 hrs. Wash under running tap
water for 2 hrs. Wash in distilled water, two changes. Dip in 95%
ethanol, two changes. Air dry. Dip slides into poly-L-lysine
solution (slide adhesive solution, 0.1% w/v in water, Sigma Cat#
P 8920). Withdraw rack, solution should wet slides uniformly and
stay on slides. Air dry slides.
*** DIN 8
PLASMID VECTORS FOR EXPRESSING PROTEINS IN DROSOPHILA TISSUE
CULTURE CELLS OR STUDYING ENHANCER FUNCTION
Michael Koelle and David Hogness, Dept. of Developmental Biology,
Beckman Center, Room B300, Stanford University School of
Medicine, Stanford, CA 94305-5427, U.S.A. 415-723-6263,
FAX/415-725-7739.
Two plasmid vectors for expression of proteins in
transfected Drosophila tissue culture cells have been
constructed.
1) pMK26 is a vector for protein expression from the actin 5C
promoter in transient transfections. It contains unique SalI,
HindIII, EcoRV, and PstI sites downstream from the Drosophila
actin 5C promoter and upstream from a fragment containing the
SV40 splice site and poly(A) addition signals. It was derived
from Bluescript+KS and pPac (Krasnow et al., Cell 57: 1031-1043,
1989).
2) pMK33 is a vector for inducible protein expression from the
metallothionein promoter. This plasmid contains a bacterial
hygromycin-resistence gene driven by the Drosophila copia
promoter, allowing the selection of stable transformed cell
lines. Unique XhoI, EcoRV, BamHI, and SpeI sites are located
downstream from a Drosophila metallothionein promoter and
upstream from the Drosophila actin 5C poly(A) addition signal.
Open reading frames inserted into this multiple cloning site will
be efficiently expressed upon addition of copper to the culture
medium. This plasmid contains fragments from pPac, pHSX-MT
(Kaufman et al., Cell 59: 359-371, 1989), and pcophyg (Rio et
al., Cell 44: 21-32, 1986).
We have also constructed a general purpose lacZ reporter
plasmid for use in Drosophila and Drosophila tissue culture
cells. This plasmid, pMK42, contains a minimal Drosophila Adh
distal promoter (from -34 to +53 with respect to the
transcription start site) driving a hybrid lacZ gene, consisting
of the Ubx untranslated leader and initiation codon, the E. coli
lacZ ORF, and SV40 splice and poly(A) addition signals. A unique
SalI site is located upstream of the Adh TATA box for the
insertion of foreign enhancer elements. pMK42 is a derivative of
pD(delta)5'-34 (Heberlein et al., Cell 41: 965-977, 1985) and
cP(beta)bxd6.2 (Irvine et al., Development 111: 407-424, 1991).
All of these plasmids have been extensively tested (e.g.
Koelle et al., Cell 67: 59-77, 1991). Further information and DNA
is available upon request. Please direct inquiries to Betty
Swyryd at the address and phone number given above.
*** DIN 8
MODIFIED pPac PLASMID FOR TRANSIENT EXPRESSION OF PROTEINS IN
TRANSFECTED TISSUE CULTURE CELLS
Lisa Urness and Carl Thummel, Howard Hughes Medical Institute,
5200 Eccles Institute of Human Genetics, Bldg. 533, Univ. of
Utah, Salt Lake City, UT 84112 U.S.A 801-581-2937, FAX/5374,
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU
The pPac plasmid was constructed by Krasnow et al. (Cell 57:
1031-1043, 1989) to allow efficient expression of proteins in
transfected Drosophila tissue culture cells. pPac contains a
single unique BamHI cloning site located between the actin 5C
promoter and poly(A) addition signal. To extend the usefulness of
this plasmid, we have inserted a polylinker into this BamHI site.
The modified vector, which we call pPacPL contains unique BamHI,
EcoRV, SpeI, XbaI, KpnI, SacI, NotI, and HpaI restriction sites
for the insertion of open reading frames. We will be happy to
provide DNA and maps to anyone interested in using this modified
vector.
*** DIN 8
DROSOPHILA INFORMATION NEWSLETTER
Volume 9, January 1993
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news/din. Material appearing in the Newsletter may be
cited unless specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 9
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail if you have
successfully signed on to the list. If you are on the list and do
not wish to receive DIN, or you want to remove a defunct address,
replace SUB in the above message with UNS. The SUB command can
also be used to correct spelling errors in your real name; the
new entry will simply replace the old as long as it was sent from
the same USERID@NODE address.
*** DIN 9
DIN Vol. 9 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>34th Drosophila Conference
>REQUESTS FOR MATERIALS
>Laboratory stock lists
>MATERIALS AVAILABLE
>Clones in 60C-D
>Libraries
>DATABASES/COMPUTING
>FlyBase
>GENETIC NOTES
>New D. sechellia w mutant
>New ri allele and its lethal interaction with H
>Updates and corrections to the Redbook
*** DIN 9
ANNOUNCEMENTS
34th ANNUAL DROSOPHILA RESEARCH CONFERENCE
The 1993 fly meetings will be held March 31-April 4, 1993,
at the Town and Country Hotel in San Diego, California. The
Program Chairman is Gerry Rubin, Life Sciences Annex Building, U.
of California, Box 539, Berkeley, CA 94720-0001 (510-643-9945,
FAX/9947). The 1993 meeting will have an experimental format that
devotes more time to poster presentations and less to slide and
plenary sessions. Registration materials can be obtained from the
GSA Administrative Office, 9650 Rockville Pike, Bethesda, MD
20814-3998 (301-571-1825, FAX/530-7079). Advance registration
deadline is January 27, 1993 (deadline for abstacts has already
passed).
*** DIN 9
REQUESTS FOR MATERIALS
LABORATORY STOCK LISTS WANTED
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405-6801, USA. 812-855-5782; FAX/2577; MATTHEWK@INDIANA.EDU.
One goal of the FlyBase project (see below) is to simplify
the process of identifying potentially useful mutations and then
locating stocks that carry those mutations. To this end, we would
like to incorporate the stock collections of as many individual
laboratories into FlyBase as possible. If you are willing to make
your laboratory stock list available, with the understanding that
only stocks not available from any of the funded stock centers
should be requested from your lab, please contact me. I would
like to have computerized lists now for immediate incorporation
into FlyBase. Hardcopy lists, if typed, are also useful; I will
convert these to machine-readable format as time permits.
*** DIN 9
MATERIALS AVAILABLE
MOLECULAR CLONING OF GENOMIC DNA FROM THE 60CD REGION
Philip J. Gotwals and James W. Fristrom, Dept. of Molecular and
Cell Biology, U. of California, Berkeley, CA 94720.
In two separate chromosomal walks, we have recovered 230
kilobases of genomic DNA in the chromosomal region uncovered by
Df(2R)Px2 (60C1/2-60D9/10). One walk was inititated by jumping
from the centromere-distal to the centromere-proximal breakpoint
of Df(2R)Px2 using a beta3-tubulin probe (Kimble et al, (1991)
Genetics 126:991). We have recovered nearly 100 kilobases of
overlapping genomic DNA, primarily carried in cosmids, around the
proximal breakpoint.
The other walk was initaited from within Df(2R)Px2 using a
fragment from the muscarinic acetylcholine receptor (MAR) gene
(Shapiro et al., (1989) PNAS 86:9030). We have recovered nearly
130 kilobases of overlapping DNA, housed in both phage and
cosmids, surrounding the MAR gene.
Anyone interested in obtaining clones from these walks or
information regarding the region should contact: Philip J.
Gotwals, HHMI, Bld. E17-225, 40 Ames St., MIT, Cambridge, MA
02139, USA. (617) 253-6452; eMAIL: PJGOTWALS@wccf.mit.edu
*** DIN 9
COMPILATION OF DROSOPHILA CDNA AND GENOMIC LIBRARIES
Carl Thummel, HHMI, 5200 Eccles Institute of Human Genetics,
Bldg. 533, U. of Utah, Salt Lake City, UT 84112, USA.
801-581-2937, FAX/5374, CTHUMMEL@HMBGMAIL.MED.UTAH.EDU
The following is a listing of Drosophila cDNA and genomic
libraries that are currently available and in common use. Please
do not request shipment of a library unless you have an immediate
use for it - many contributors are concerned about the time and
money involved in mailing their libraries. Also, please inquire
with local colleagues before requesting a library since many of
these libraries are already widely distributed.
cDNA LIBRARIES
--Nick Brown, Wellcome/CRC Institute, Tennis Court Rd, Cambridge
CB2 1QR UK. Phone: 44-223-334128; FAX: 44-223-334089, Email:
NB117@MB1.BIO.CAM.AC.UK
Vector/Insertion/Complexity/mRNA source
pNB40/see ref./3x10[5]/0-4 hr embryo
pNB40/see ref./3x10[6]/4-8 hr embryo
pNB40/see ref./3x10[5]/8-12 hr embryo
pNB40/see ref./1x10[6]/12-24 hr embryo
pNB40/see ref./3x10[6]/imaginal discs
The Drosophila strain used is an isogenic second chromosome
stock: dp cn bw, from the Gelbart lab. Ron Blackman has made a
genomic library from this same strain (see below). The vector is
a pUC based plasmid with a SP6 promoter at the 5' end of the cDNA
and a T7 promoter at the 3' end of the cDNA. The cloning strategy
was directional and designed to maximize the number of full-
length cDNAs. A useful diagnostic of full-length cDNAs is a non-
coding G nucleotide at the 5' end, after the polyC tract; the
origin of this nucleotide is, however, unknown.
Reference: Brown, N.H., and F.C. Kafatos (1988) Functional cDNA
libraries from Drosophila embryos. J. Mol. Biol. 203: 425-437.
--Steve Russell, Dept. of Genetics, Univ. of Cambridge, Downing
St., Cambridge, CB2 3EH UK. Phone: 44-223-337733, FAX:
44-223-333992,
Email: SR120@MOLECULAR-BIOLOGY-1.BIOLOGY.CAMBRIDGE.AC.UK.BITNET
All libraries were made with RNA isolated from Oregon R strain
Vector/Insertion/Complexity/mRNA source
NM1149/RI/2x10[6]/Male 3rd instar larvae
NM1149/RI/6x10[5]/Female 3rd instar larvae
NM1149/Directional: RI-HIII/3x10[6]/Adult male heads
NM1149/Directional: RI-HIII/1x10[6]/Adult female heads
lambda gt11/RI/3x10[5]/Testes
--Charles P. Emerson, Jr. or Mary Beth Davis, Biology Dept.,
Univ. of Virginia, Charlottesville, Virginia, 22901 USA.
Phone: 215-728-5283 (Emerson); 215-728-5284 (Davis); FAX:
215-728-2412, Email: emerson@castor.rm.fccc.edu or
davis@castor.rm.fccc.edu
Vector/Insertion/Complexity/mRNA source/Titer
lambda gt10/RI/1x10[6]/late pupae/1x10[10]
Blunt-ended cDNA was ligated to EcoRI adaptors, then ligated to
EcoRI digested gt10 lambda arms. We have isolated cDNA clones
corresponding to MHC isoforms that were lengths of 5940 and 5500
bases.
Reference: George, E.L., M.B. Ober, and C.P. Emerson, Jr. (1989)
Functional domains of the Drosophila melanogaster muscle myosin
heavy-chain isoform are encoded by alternatively spliced exons.
Mol. Cell Biol. 9: 2957-2974.
--Bruce Hamilton, Division of Biology 216-76, California
Institute of Technology, Pasadena, CA, 91125, USA. Phone:
818-356-8353; FAX: 818-449-0756, Email: BAH@citromeo.bitnet or
BRUCE@seqvax.caltech.edu
Library name/Vector/Insertion/Complexity/mRNA source
Head M/lambda EXLX/ApaI-SacI/1.1x10[7]/Oregon R adult heads
Head P/lambda EXLX/ApaI-SacI/9x10[6]/Oregon R adult heads
Head 1.2/lambda EXLX/ApaI-SacI/2.7x10[6]/Oregon R adult heads
Head 2.0/lambda EXLX/ApaI-SacI/1.2x10[6]/Oregon R adult heads
Adult/lambda EXLX/ApaI-SacI/>1x10[6]/Oregon R adults
0-24 mojo/lambda EXLX/ApaI-SacI/3.4x10[6]/Can S, 0-24 hr embryos
All libraries were cloned directionally into the ApaI-SacI sites
of lambda EXLX, as described in ref. 1, with internal restriction
sites protected. Lambda EXLX allows in vivo excision of plasmid
DNA using a CRE/loxP site-specific recombination system. This
vector also allows regulated expression of the insert DNA as a
phage T7 gene 10 N-terminal/cDNA fusion protein, under the
control of a T7 RNA polymerase promoter (1). The Head 1.2 library
was prepared from cDNAs that were size-selected for molecules 1.2
kb or larger by fractionation through an agarose gel. Head 2.0
contains cDNAs that are 2 kb or larger. The cDNA for the Adult
library was not size-fractionated. The Adult and mojo libraries
were published in ref. 1. The Head M and Head P libraries are
unpublished, but I have asked people who use them to refer to
ref. 1, since they were constructed in the same way and in the
same vector. The two size-selected libraries, Head 1.2 and Head
2.0 were published in ref. 2, which also describes a rapid
screening procedure that is very straightforward.
References:
1. Palazzolo et al (1990) Gene 88, 25-36.
2. Hamilton et al (1991) Nucl. Acids Res. 19, 1951-1952
--Tom Kornberg, Department of Biochemistry, University of
California, San Francisco, CA 94143 USA. Phone: 415-476-8821,
FAX: 415-476-3892, Email: tomk@ucsf.cgl.edu
Our cDNA libraries were prepared from RNA isolated from Oregon R
animals, with the cDNA sequences inserted into the EcoRI site of
lambda gt10. Libraries will be shipped by Federal Express.
Requests should be accompanied by an appropriate Federal Express
Authorization Number.
Stage/Library designation/Complexity
0-3 hr embryo/D/300,000
3-12 hr embryo/E/500,000
12-24 hr embryo/F/300,000
1st and 2nd instar/G/200,000
early 3rd instar/H/300,000
late 3rd instar/I/300,000
early pupal/P/300,000
late pupal /Q/300,000
adult male/R/300,000
adult female/S/300,000
Reference: Poole, S., Kauvar, L.M., Drees, B., and Kornberg, T.
(1985) The engrailed locus of Drosophila: Structural analysis of
an embryonic transcript. Cell 40: 37-43.
--Carl S. Thummel, Dept. of Human Genetics, 5200 Eccles
Institute, Bldg. 533, University of Utah, Salt Lake City, Utah,
84112 USA. Phone: 801-581-2937, FAX: 801-581-5374, Email:
cthummel@hmbgmail.med.utah.edu
Vector/Insertion/Complexity/mRNA source
lambda gt10/RI/1x10[6]/larval tissues cultured in vitro with
cycloheximide + ecdysone
lambda ZAP/RI/3x10[5]/late 3rd instar larvae
lambda ZAP/RI/4x10[5]/0-1 day prepupae
The late third instar cDNA library is available in two size-
fractionations that are enriched for either 1-3 kb or 3-6.5 kb
cDNAs. Both libraries, however, do contain some smaller inserts.
--Peter Tolias, Public Health Research Institute, 455 First Ave.,
New York, New York, 10016 USA. Phone: 212-578-0815, FAX:
212-578-0804, Email: tolias@wombat.phri.NYU.EDU
Vector/Insertion/Complexity/mRNA source
lambda gt22A/SalI-NotI/5x10[5]/Canton S ovaries, stages 1-14
This is a cDNA expression library in which the inserts are
directionally cloned. A SalI site is present at the 5' end and a
NotI site is at the 3' end.
--Kai Zinn, Division of Biology, 216-76, Caltech, Pasadena, CA
91125, USA. Phone: 818-356-8352, FAX: 818-449-0679,
Email: kai@seqvax.caltech.edu
Vector/Insertion/Complexity/mRNA source
lambda gt11/EcoRI/1.2x10[6]/Oregon R, 9-12 hr embryos
The complexity is an underestimate for larger cDNAs, since it was
>5X size-selected for cDNAs larger than 1.8 kb. The complexity
could thus be as high as 6x10[6] for these larger inserts.
GENOMIC LIBRARIES
--Winifred W. Doane, Dept. of Zoology, Arizona State University,
Tempe, Arizona 85287-1501 USA. Phone: 602-965-3571, FAX:
602-965-2012, Email: icwwd@asuacad
Vector/Insertion/Complexity/DNA source
pWE15/BamHI/4x10[4]-1x10[6]/Amy[1,6] mapP[12] strain of D.
melanogaster
This cosmid vector contains a T3 and T7 promoter on either side
of the insertion site, to facilitate the preparation of end-
specific probes for chromosomal walking.
Reference: Thompson, D.B., and Doane, W.W. (1989) A composite
restriction map of the region surrounding the Amylase locus in
Drosophila melanogaster. Isozyme Bull. 22: 61-62.
--Ron Blackman, Dept. of Cell and Structural Biology, 505 S.
Goodwin Ave., Univ. of Illinois, Urbana, Illinois 61801 USA.
Phone: 217-333-4459, FAX: 217-244-1648, Email:
Ron_Blackman@qms1.life.uiuc.edu
Vector/Insertion/Complexity/DNA source
lambda EMBL3/BamHI/1x10[6]/Adult Drosophila virilis
lambda EMBL3/BamHI/1x10[6]/Embryonic D. melanogaster, see below
Both libraries were prepared by MboI partial digestion of the DNA
and insertion into the BamHI site of lambda EMBL3. The inserts
can be excised by digestion with SalI. Titer is approximately
5x10[9] pfu/ml. The D. melanogaster genomic library is made from
animals that are isochromosomal for chromosome 2, dp cn bw. The
same strain was used by Nick Brown for his cDNA libraries.
--Howard Lipshitz, Division of Biology, 156-29, California
Institute of Technology, Pasadena, CA 91125, USA. Phone:
818-356-6446, FAX: 818-564-8709, Email: HDL@ROMEO.CALTECH.EDU
Vector/Insertion/Complexity/DNA source
Charon 4/EcoRI/6x10[5]/Canton S embryos
This is the original Drosophila genomic library from the Maniatis
lab. It has been amplified several times but is still useful for
most purposes.
Reference: Maniatis et al., The isolation of structural genes
from libraries of eucaryotic DNA. Cell 15: 687-701.
*** DIN 9
DATABASES/COMPUTING
FLYBASE - A DROSOPHILA GENETIC DATABASE, RELEASE 9301
The FlyBase Consortium (see below for names and addresses)
{Editors' note: The following document has been edited for
DIN; section 6 has been omitted, section 8 has been truncated to
include only a list of subdirectories and not the files within
them, and section 9 has been omitted. The complete document is
available from FlyBase as described below.}
CONTENTS OF THIS DOCUMENT
1. What is FlyBase
2. The FlyBase Consortium
3. How to contact FlyBase
4. How to obtain FlyBase
5. How to reference FlyBase
6. Differences between printed and computer versions of FlyBase
{omitted}
7. Allied databases
8. The structure of FlyBase {truncated}
9. Detailed description of FlyBase {omitted}
10. Future plans for FlyBase
11. Release notes
12. Full addresses of members of the FlyBase Consortium
13. The copyright of FlyBase
13. Acknowledgements
1. WHAT IS FLYBASE
FlyBase is a comprehensive database for information on the
genetics and biology of Drosophila. It is, or will be (see
below), available in several different formats. That released now
is a series of flat files in which different data are displayed.
FlyBase includes (by permission of Academic Press) all of the
material of the Redbook, i.e. The Genome of Drosophila
melanogaster by D.L. Lindsley and G. G. Zimm (Academic Press,
1992). A short introduction to FlyBase is to be found in the file
flybase/about-flybase.txt.
2. THE FLYBASE CONSORTIUM
FlyBase is being built by a Consortium of researchers funded by
the National Institutes of Health. This Consortium includes both
Drosophila biologists and computer scientists. The Consortium is
split between four sites, at Harvard, Cambridge (England),
Bloomington and Los Angeles. In addition the Consortium has very
close links with the National Center for Biotechnology
Information in Washington and with several other workers who
provide us with data, either for FlyBase itself or for one of its
allied databases. The members of the Consortium are:
o Biological Laboratories, Harvard University:
William Gelbart (PI)
Wayne Rindone
Joe Chillemi
o Dept. of Genetics, University of Cambridge:
Michael Ashburner
Rachel Drysdale
Aubrey de Grey
o Dept. of Biology, Indiana University, Bloomington:
Thomas Kaufman
Kathy Matthews
Don Gilbert
o Dept. of Biology, University of California, Los Angeles:
John Merriam
Beverley Matthews
Soon-Young Huh
o National Center for Biotechnology Information, NIH,
Washington:
Carolyn Tolstoshev
3. HOW TO CONTACT FLYBASE
FlyBase has established a central e-mail address to which all
communications and questions can be sent. This is:
o FLYBASE@NUCLEUS.HARVARD.EDU
Communications or questions about the Indiana fileserver may be
addressed to:
o FLYBASE@BIO.INDIANA.EDU
We very much welcome corrections and additions to the data in
FlyBase, comments about the types of data the we now (or should)
make available or about the structure of FlyBase. FlyBase is
meant to serve the Drosophila community. Only if we receive some
feedback from the community will we know how best to do this.
Many of the working papers between members of the FlyBase
Consortium are publicly available (see below). The full mail
addresses, with telephone and fax numbers and e-mail addresses,
of the members of the Consortium are given in the penultimate
section of this document.
4. HOW TO OBTAIN FLYBASE
FlyBase will be made available in several different ways and
formats. These will include direct access to FlyBase servers,
versions for stand alone access on different computer platforms,
flat files and as printed text (as special issues of Drosophila
Information Service, of which DIS 69 was a prototype) (see
"Future plans for FlyBase"). In its present form FlyBase is only
available as a series of flat files although these can be browsed
and queried interactively using publicly available software (see
below). The prime archive of FlyBase is maintained on a publicly
accessible computer at the Department of Biology, Indiana
University (IUBio). The files can be obtained in two ways, either
interactively using a Gopher Client (see below) or by anonymous
FTP (File Transfer Protocol). A subset of FlyBase files are also
kept on several other computers, from where they are available
either interactively or by anonymous FTP. If all of this is
mysterious to you, contact Don Gilbert, Wayne Rindone or Aubrey
de Grey, by mail or phone, for help (see below for contact
numbers).
WAIS/Gopher: By far the easiest way to access FlyBase is
with a Gopher Client. Gopher is a program that runs on a variety
of computer platforms (including Macs). To use Gopher you need
three things - a suitable computer, access to Internet and a
Gopher Client. We cannot help you for the first of these but in
view of the plans to make FlyBase available using X-windows
software we recommend that, if purchasing, you buy a computer
that can support X-windows. For Internet access you must consult
your local computer advisors. For those without direct network
access there are commercial companies that provide Internet
access across telephone lines using modems. The Gopher Client
software is available by anonymous ftp from
boombox.micro.umn.edu, in the directory /pub/gopher/, or from
ftp.bio.indiana.edu, in the directory /util/gopher/.
Services on the IUBio Gopher host are also available using
WAIS client software. WAIS is the Wide Area Information System.
Client software is available for a variety of computer platforms
by FTP from IUBio (in the directory /util/wais) and
ftp.think.com. It may be convenient, if your main use of Gopher
is to search FlyBase, to set up your Gopher client so that access
to Indiana is the default. Two of the great advantages of using
Gopher are (a) that it allows you to search files interactively
and (b) that you need not understand the structure of the FlyBase
files. What Gopher provides is an interactive search of the flat
files of FlyBase and the ability to transfer all or part of any
file back to your home computer. FlyBase is accessible from the
Gopher hole at Indiana (IUBio) and most of the files (but not
those from the Redbook) are also accessible from the Gopher hole
at the Biozentrum in Basel. The link to add to your Gopher server
to tunnel to Indiana is:
Name=IUBio Biology Archive, Indiana University
(experimental)
Type=1
Port=70
Path=1/
Host=ftp.bio.indiana.edu
The link for the Basel Biozentrum host is:
Name=bioftp EMBnet Switzerland (experimental)
Type=1
Port=70
Path=
Host=bioftp.unibas.ch
The WAIS source for the Indiana archive (IUBio) is:
(:source
:version 3
:ip-address "129.79.224.25"
:ip-name "ftp.bio.indiana.edu"
:tcp-prot 210
:database-name "INFO"
:cost 0.00
:cost-unit none
:maintainer "archive@bio.indiana.edu"
:description "
This WAIS service includes several indexed Biology
Information sources, including Genbank nucleic acid sequence
databank, Drosophila genetics, Biosci/Bionet network news, and
others.
File Transfer Protocol (FTP): FlyBase is available by File
Transfer Protocol (FTP) from several sources. However only
Indiana has the complete set of files. The other sites have most
files except those that include the Redbook data. Note that since
most of these machines run Unix, the commands and names of
directories and files are case sensitive. The FTP servers from
which FlyBase is now available are:
FTP.BIO.INDIANA.EDU (129.79.224.25). Login with the username
anonymous and use your e-mail address as password. FlyBase
is in the directory flybase/.
NCBI.NLM.NIH.GOV (130.14.20.1). Login with the username anonymous
and use your e-mail address as password. FlyBase is in the
directory repository/FlyBase.
FTP.EMBL-HEIDELBERG.DE (192.54.41.33). Login with the username
anonymous and use your e-mail address as the password.
FlyBase is in the directory /pub/databases/flybase.
SUNBCD.WEIZMANN.AC.IL (132.76.64.79). Login with the username
anonymous and your e-mail address as the password. FlyBase
is in the directory /pub/databases/flybase.
FTP.NIG.AC.JP (133.39.16.66). Login with the username anonymous
and your e-mail address as password. FlyBase is in the
directory /pub/db/flybase. Once logged in to an FTP server
the following commands can be used to obtain one or more
FlyBase files onto your own computer:
ftp> cd {directory name} (i.e. cd flybase if using IUBio)
ftp> get /documents/full.doc
ftp> get/genes/loci.txt
. et cetera
. or
ftp> mget *.txt (to retrieve all text files)
ftp> quit
For those without access to FTP there is a gateway between
BITNET/EARN and the FTP part of IP at Princeton. This allows you
to make an FTP request by BITNET/EARN mail, the file(s) requested
from the remote site being forwarded to you as mail from
Princeton. This gateway is known as BITFTP. For information on
how you use it send the one-line message HELP to
BITFTP@PUCC.BITNET. In brief, this service is used by sending a
MAIL message (using BITNET) to BITFTP@PUCC as follows:
FTP ftp.bio.indiana.edu NETDATA
USER anonymous guest
<now the FTP commands as if you were doing this directly;
see above>
QUIT
The files will then be returned to you by e-mail.
Netserver: These files are available from the Netserver at EMBL,
and if you do not have the facility for FTP this is a way to get
them. For general help and a listing of files on the EMBL
Netserver send an e-mail message to NETSERV@EMBL-HEIDELBERG.DE
with the text HELP FLYBASE. To obtain a particular file send an
e-mail message with the text GET FLYBASE:FILENAME to
NETSERV@EMBL-HEIDELBERG.DE, where FILENAME is one of the
filenames listed above.
Direct logon access in the UK: In the UK FlyBase is available on
both the SEQNET and HGMP facilities. The SERC SEQNET computing
facility at the Daresbury Laboratory (UK.AC.DL.SEQNET) can be
directly accessed via JANET. For an account write to Dr. Alan
Bleasby, SERC Daresbury Laboratory, Warrington WA4 4AD, Cheshire
or send e-mail to AJB@UK.AC.DARESBURY. FlyBase is kept in a
directory called /data/flybase. The MRC Human Genome Mapping
Project is also accessed via JANET (MENU.CRC.AC.UK). Applications
for an account should be sent to The HGMP Resource Centre,
Clinical Research Center, Watford Road, Harrow, Middx HA1 3UJ.
Access to FlyBase is via the menu.
CD ROM: Most of the files of FlyBase (except those of the
Redbook) are included in the NCBI Data Repository and EMBL CD-
ROMs. These are released periodically and are available from the
NCBI Data Repository, National Library of Medicine, Bldg. 38A, Rm
8N-803, NIH, Bethesda, MD 20894 ((1)-301-496-2475) or from the
EMBL Data Library, Postfach 10.2209, 6900 Heidelberg, Germany
(phone (49)-6221-387258; fax (49)-6221-387519). Dr. Amos Bairoch
has made this database available as ascii files on CD ROM.
Contact Dr. A. Bairoch, Department of Medical Biochemistry,
University of Geneva, Geneva, Switzerland. e-mail:
BAIROCH@CMU.UNIGE.CH.
5. HOW TO REFERENCE FLYBASE
We suggest FlyBase be referenced in publications in the following
manner: FlyBase (1993). A Drosophila Genetic Database. Available
from the FTP.BIO.INDIANA.EDU network server.
6. DIFFERENCES BETWEEN PRINTED AND COMPUTER VERSIONS OF FLYBASE
[omitted]
7. ALLIED DATABASES
It is both undesirable and impossible for literally all data on
Drosophila to be kept within FlyBase. However, FlyBase wishes to
encourage collaboration between other workers who are building
different or more specialized Drosophila databases. For this
reason FlyBase has established the concept of allied databases.
These databases are explicitly attributed to their authors, who
are responsible for the data they include. FlyBase encourages
other members of the community to make their databases available
associated to FlyBase. In particular, FlyBase encourages other
database curators to cross-reference FlyBase to ensure
consistency in, for example, gene names and symbols. FlyBase
offers help to other curators in both ensuring nomenclatural
consistency and in making their databases publicly available
through FlyBase. The allied databases now available are listed in
the detailed description of FlyBase, below.
8. THE STRUCTURE OF FLYBASE
The presently available version of FlyBase is a series of files
arranged in a hierarchical structure of directories and
subdirectories. An inconvenience of this is that file names can
become very long. However, on Unix operating systems, access to a
particular directory can be limited by using the cd (change
directory) command. The command cd .. (i.e. cd followed by a
space and then two periods) will take you up one directory level.
Against the disadvantage of cumbersome file names this structure
is very logical and easy to maintain. Files are of different
types, indicated by the suffixes to their names:
.doc an explanatory document, in plain text.
.txt a file in plain text, may be data, documentation or
other information.
.rpt a formatted data file, suitable for viewing by people,
in plain text.
.rtf a rich-text file, best read with common word
processors, but also readable by people, in plain text.
.gif an image file (graphic interchange format). Use a gif
viewer to see.
.ps a postscript image file. Use a postscript viewer or
printer.
.tar.Z a Unix compressed archive file. Use uncompress and tar
to extract.
.hqx a Macintosh binhex archive file. Use stuffit to
decompress.
.zip an MSDos compressed archive file. Use unzip to extract.
There now follows the complete structure of the FlyBase files as
kept on the IUBio server. The structure may differ when FlyBase
is mounted on other computers, but should reflect this structure
in a logical way. A detailed description of the contents of each
file is given in the next section of this document. Some files
have yet to be implemented, but they have been listed here as it
is expected that they will be available very soon. If you are
using FlyBase through a Gopher client the details of this
organization are irrelevant, as you will be presented with the
available files by the interactive Gopher menu.
flybase/
flybase/redbook
flybase/redbook/genes
flybase/redbook/lethals
flybase/redbook/aberrations
flybase/redbook/miscellany
flybase/genes
flybase/aberrations
flybase/maps
flybase/function
flybase/clones
flybase/stocks
flybase/stocks/stock-centers
flybase/stocks/stock-centers/bloomington
flybase/stocks/labs
flybase/references
flybase/miscellany
flybase/sequences
flybase/people
flybase/news
flybase/news/news
flybase/news/oldnews
flybase/news/din
flybase/documents
flybase/documents/full.doc {i.e. this document}
flybase/working-papers
flybase/allied-data
9. DETAILED DESCRIPTION OF FLYBASE {omitted}
10. FUTURE PLANS FOR FLYBASE
In this section of the documentation we indicate some of the
future directions we are taking with the building of FlyBase.
This text is supplemented by the papers in the files of
flybase/working-papers. We encourage the fly community to respond
to what we are doing - let us know (by e-mail to
FLYBASE@NUCLEUS.HARVARD.EDU or by regular mail to any of us) if
you think we are not doing something that should be done, or are
doing something that should not be done. Only by feedback from
the community will we produce a product of the greatest utility
to all. As we have explained elsewhere in this document the
present release of FlyBase is seen very much as a temporary
measure, until the full relational schema has been implemented.
The relational schema: FlyBase is being built and will be
maintained in a commercial relational database management system
called Sybase. The design of the relational schema can be found
in a series of files in flybase/working-papers/sybase-*. This
schema was designed by Carolyn Tolstoshev. It is not yet stable -
that is to say changes to the schema are still being made as a
consequence of experience and discussion. The Harvard group are
now implementing and testing this schema prior to the importation
of data.
The data: Any database is only as good as its data and the
way these data are interrelated. At present, FlyBase data are
available as a series of independent tables with few
relationships between them. Not only does this mean that there
are major inconsistencies between tables (e.g. a gene may have
one symbol in one table but another in a second) but also it
means that the user cannot automatically go from e.g. the loci
table to a stock table. One of the major tasks that is now being
done is to force consistency between tables.
1. The bulk of the genetic data is now in two sets of
directories, flybase/redbook - the text material of Lindsley and
Zimm, and flybase/genes and flybase/aberrations (with
flybase/maps, flybase/function, flybase/references). The
Cambridge group is now integrating these two sets of tables into
a single structure. This will, in effect, be the replacement of
the Redbook. Since science does not stop simply because we are
building this database the Cambridge group is also continuously
updating the data, by scanning the literature.
2. There are now several different tables of clone data. These
are being integrated and continuously updated by the Los Angeles
group. This group is also developing software for the graphical
display of molecular data.
3. References can now be found in three different sets of tables,
those in flybase/redbook, flybase/genes and
flybase/clones/clonelist.txt. Not only is there redundancy
between these but each set differs in its reference format. The
Cambridge group is dealing with this problem by building a single
Drosophila reference file. The objective is to have as complete a
bibliography on Drosophila biology as possible with all entries
in uniform format. The sources of this bibliography are several:
the published bibliographies (Morgan et al. 1925, Muller,
Herskowitz and some smaller more specialized ones) are being read
by an optical character reader; we have concluded a license
agreement with MEDLINE giving us a retrospective download from
1966 (the year MEDLINE introduced computer files) with monthly
updates from January 1993 (these entries will include abstracts)
and Dr. G. Bachli's computer bibliography, which is especially
strong on taxonomic and faunistic papers. When these have all
been entered, duplicate entries removed and reformatted they will
be checked against the large Drosophila offprint collection in
Cambridge for errors and omissions. This reference table will
serve all of the other tables of FlyBase. Users will be able to
recover references from it in a variety of formats (e.g. that
used by ENDNOTE).
4. The Bloomington group is working on the problem of stock
lists, not only collecting stock lists from other laboratories
(see flybase/stocks.doc) but also ensuring a consistency in
format, so that all can be seen in a similar way. We hope to
publish a recommendation for stock list format, with the hope
that others will use it and reduce the problems we have in
displaying stock list data. The second major problem with the
stock lists is to ensure that they are consistent in the symbols
used for genes, alleles, aberrations and insertions.
5. There are now several different files of addresses and/or e-
mail addresses. These have been gathered from various sources.
The aim is to have a single address file, in a consistent format.
This work is being done in Bloomington.
6. The formal description of chromosome aberrations, in a manner
suitable for manipulation by computer programs, is a difficult
problem. One approach is that discussed in flybase/working-
papers/aberration-syntax.txt. We are writing software that will
allow efficient searching of the aberration tables for, e.g.,
breakpoints within a specific chromosome region, and allow the
graphical display of aberrant chromosomes.
Output: Although FlyBase will be built and maintained in
Sybase we expect few to have the skills to use it as such or to
have the very considerable cash required for a Sybase operating
license. For this reason we are building a number of output
products that will make FlyBase available to as wide a community
as possible. (The Sybase implementation will be publicly
available should any users need it.)
1. The simplest output will be printed text. We have, in pre-
Consortium days, experimented with this with a special volume of
DIS (DIS 69) compiled by Michael Ashburner and edited (and
distributed) by William Gelbart. It is our intention to publish
such special issues of DIS whenever the amount of new data
warrants. By doing this we will ensure that even those workers
who have no access to computers or networks will not be
disenfranchised. These issues of DIS will be produced as output
from the Sybase tables.
2. The presentation of FlyBase as a series of ascii flat files on
computer servers will be maintained. The prime server will be
that at IUBio and the Bloomington group will continue to make
improvements in access and display of these tables. By far the
easiest way to access these files is by using a Gopher client
(see "How to obtain FlyBase"). In addition these tables will be
distributed, as now, to a number of major servers used by
biologists and will be included on the CD-ROMs being distributed
by NCBI, EMBL and others.
3. There is now strong interest in the development of software to
display databases such as FlyBase interactively using X-windows
systems. We are developing such tools for use with FlyBase. We
are concentrating our efforts in two ways. The first is to
exploit the software tools written at the NCBI for use with their
Entrez system. The second is to develop the programs written by
Richard Durbin and Jean Thierry-Meig for the C. elegans
database - acedb. acdeb is now being modified for Drosophila data
in Berkeley and we are collaborating with Suzanna Lewis to make
these programs suitable for the display of FlyBase. These
implementations of FlyBase will be available from the IUBio
server (and probably from other servers), on CD-ROM and perhaps
on floppy discs. To make use of them you will need a computer
that can implement X-window software (or its equivalent). A color
monitor would be a great advantage.
11. RELEASE NOTES
Since FlyBase is still kept as a series of independent tables the
concept of a "release" or "version" of the database is difficult
to apply. However, while this format continues we will signal new
releases (as yearmonth) whenever we consider that there has been
a sufficient change in data or organization to warrant it. New
versions of particular tables may well be released without
obvious notice. One way of finding out is to look at the date
that a particular file was last modified on IUBio. This can be
done by FTP using the dir command in the flybase directory. The
last update of a file is automatically displayed by Gopher. The
individual document files will be kept up to date and they will
indicate any changes in organization or major changes in content.
The last update of the .doc files is displayed on the top line of
each.
Release 9301 of FlyBase is the first by the Consortium. It
is released as a temporary measure to make the data that is in
FlyBase already available to the community. In large part 9301 is
simply a restructuring of data that had been previously available
from IUBio and other sources. It includes the tables from the
9209 release of Michael Ashburner (see
flybase/news/oldnews/1992.txt). These tables include 5321 loci,
4218 entries in the genetic map, 11940 aberrations and 3120
references. Note that of the 5321 loci, about 800 are not in
Lindsley and Zimm (1992). The great majority of the references
are also subsequent to Lindsley and Zimm. This release includes
tables from the 3/06/1992 release of John Merriam's clone lists.
12. FULL ADDRESSES OF MEMBERS OF THE FLYBASE CONSORTIUM
William Gelbart, Biological Laboratories, Harvard University, 16
Divinity Avenue, Cambridge, Massachusetts 02138, USA.
Telephone: (1)-617-495-2906; fax: (1)-617-495-9300; e-mail:
GELBART@MORGAN.HARVARD.EDU.
Wayne Rindone, Biological Laboratories, Harvard University, 16
Divinity Avenue, Cambridge, Massachusetts 02138, USA.
Telephone: (1)-617-496-5668; fax: (1)-617-495-9300; e-mail:
RINDONE@MORGAN.HARVARD.EDU.
Joe Chillemi Biological Laboratories, Harvard University, 16
Divinity Avenue, Cambridge, Massachusetts 02138, USA.
Telephone: (1)-617-496-5667; fax: (1)-617-495-9300; e-mail:
JOEC@MORGAN.HARVARD.EDU.
Michael Ashburner, Department of Genetics, University of
Cambridge, Downing Street, Cambridge, CB2 3EH, England.
Telephone: (44)-223-333969; fax: (44)-223-333992; e-mail:
MA11@GEN.CAM.AC.UK.
Rachel Drysdale, Department of Genetics, University of Cambridge,
Downing Street, Cambridge, CB2 3EH, England. Telephone:
(44)-223-333963; fax: (44)-223-333992; e-mail:
RD120@GEN.CAM.AC.UK.
Aubrey de Grey, Department of Genetics, University of Cambridge,
Downing Street, Cambridge, CB2 3EH, England. Telephone:
(44)-223-333963; fax: (44)-223-333992; e-mail:
AG24@GEN.CAM.AC.UK.
Thomas Kaufman, Department of Biology, Indiana University,
Bloomington, Indiana 47405, USA. Telephone (1)-812-855-3033;
fax: (1)-812-855-2577; e-mail: KAUFMAN@BIO.INDIANA.EDU.
Kathy Matthews, Department of Biology, Indiana University,
Bloomington, Indiana 47405, USA. Telephone (1)-812-855-5782;
fax: (1)-812-855-2577; e-mail: MATTHEWK@UCS.INDIANA.EDU.
Don Gilbert, Department of Biology, Indiana University,
Bloomington, Indiana 47405, USA. Telephone (1)-812-855-7807;
e-mail: GILBERT@BIO.INDIANA.EDU.
John Merriam, Department of Biology, University of California at
Los Angeles, Los Angeles, California 90024-1606, USA.
Telephone: (1)-310-825-2256; fax: (1)-213-206-3987; e-mail:
IBENAPR@OAC.UCLA.EDU.
Beverley Matthews, Department of Biology, University of
California at Los Angeles, Los Angeles, California
90024-1606. Telephone: (1)-310-825-2256; fax: (1)-213-206-
3987.
Soon-Young Huh, Department of Biology, University of California
at Los Angeles, Los Angeles, California 90024-1606.
Telephone: (1)-310-825-2256; fax: (1)-213-206-3987; e-mail:
SHUH@AGSM.UCLA.EDU.
Carolyn Tolstoshev, National Center for Biotechnology
Information, National Institutes of Health, 8600 Rockville
Pike, Bethesda, Maryland 20894, USA. Telephone:
(1)-301-496-2475; fax: (1)-301-480-9241; e-mail:
CAROLYN@NCBI.NLM.NIH.GOV.
13. THE COPYRIGHT OF FLYBASE
The files containing the text of Lindsley and Zimm (1992) The
genome of Drosophila melanogaster are the copyright of Academic
Press and are redistributed in FlyBase by their agreement. These
files cannot be redistributed by users without the explicit
permission of Academic Press. The copyright of FlyBase itself is
held by the Genetics Society of America.
14. ACKNOWLEDGMENTS
FlyBase is supported by a grant from The National Center for
Human Genome Research. In addition support has come from the HGMP
Programme of the MRC (London) in the form of both hardware and
software. Work in John Merriam's group has been supported by a
grant from the National Library of Medicine. The Drosophila Stock
Center at Bloomington is supported by NSF's Division of
Instrumentation and Resources. We acknowledge the help of Dr.
Phyllis Moses (Academic Press) and Dr. D.L. Lindsley in making
the Redbook data available to FlyBase. We thank Drs. D.J. Lipman
and J. Ostell and the staff at the NCBI in Washington for their
help in getting FlyBase launched. We are very grateful to Rainer
Fuchs at EMBL, Amos Bairoch in Geneva, Alan Bleasby at Daresbury,
Scott Federhen at the NCBI, Yoshihiro Ugawa and Takashi Gojobori
at the DDBJ, Martin Bishop at the HGMP and Reinhard Doelz at the
Biozentrum for helping to make this database available. Thanks
too to John Garavelli (PIR), Rainer Fuchs (EMBL) and Amos Bairoch
(Geneva) for help in cross-checking between FlyBase and the
Nucleic Acid/Protein databases. We also thank Dr. G. Bachli
(Zurich) for a substantial contribution to the bibliographic
file.
*** DIN 9
GENETIC NOTES
A NEW MUTANT OF D. SECHELLIA
Isaya Higa and Yoshiaki Fuyama, Dept. of Biology, Tokyo
Metropolitan U., Hachioji-Shi, Tokyo 192-03, Japan.
81-426-77-2575, FAX/2559; A910741@JPNTMU00.BITNET.
A new white (w) mutant of D. sechellia spontaneously
occurred in an iso-female strain originally collected in Plaslin
Island, Seychelles in 1986. General features are the same as
those of white of D. simulans and white[1] of D. melanogaster.
Homozygote fertile and viability normal. Sex-linked and
recessive. Does not complement white of D. simulans.
*** DIN 9
NEW RADIUS INCOMPLETUS ALLELE AND ITS LETHAL INTERACTION WITH
HAIRLESS
Petter Portin and Mirja Rantanen, Laboratory of Genetics, Dept.
of Biology, U. of Turku, SF-20500 Turku, Finland.
SEPNE@SARA.CC.UTU.FI
In June 1992 we began to suspect that a spontaneous radius
incompletus (ri) mutation had occurred in our Ax[ts1] stock. We
mapped this mutation with the aid of cu and es mutations, and
found that the new mutation really mapped to the position of ri
(3-47.0). Our new mutation failed to complement ri, and
consequently it was named ri[92f].
Even earlier we had found that in the cross ri[92f] cu es x
H es cd/In(3R)P, spr only non-ebony progenies appeared. Therefore
we concluded that the interaction of ri and H is lethal even
though both are in a heterozygous condition.
*** DIN 9
CORRECTIONS FOR REDBOOK
Dan Lindsley and Georgianna Zimm, Dept. of Biology, U. of
California, La Jolla, CA 92093. 619-534-3109, FAX/0053.
p=page, L=left, R=right
p2L, line 12: choromosomes > chromosomes
p8R, ABO table footnote: Sander> Sandler
p25L, Ama-1: alpha-amanatin> alpha-Amanatin
p41R, zen: Location> location
p71R, bottom of page: Add entry "bcd:: see ANTC"
p100: Add entry "Ubx[16K] X ray Ramey In(3R)79D;89B Ubx"
p100: Add entry "Ubx[42T] X ray In(3R)70D;89E Ubx"
p100: Add entry "homozygous lethal" to last column of Ubx[130].
p101: Add entry "; T(2;3) " to cytology column and entry "Ubx" to
type column of Ubx[A]
p109: Add entry "extreme Ubx" to type column of Ubx[U]
p109R: Add entry "cel: see l(3)84Ab"
p128R: Add entry "cry: see Su(Ste)"
p128R: Add entry "crystal: see Su(Ste)"
p142L: Add entry "da[12] 7 recessive lethal"
p142L: Add entry "da[13] 7 recessive lethal"
p142L: Add entry "da[14] 7 recessive lethal"
p142L: Add entry "da[15] 7 recessive lethal"
p142L: Add entry "da[16] 7 recessive lethal"
p142L: Add entry "da[17] 7 recessive lethal"
p142L: Add entry "da[18] 7 recessive lethal"
p142L: Add entry "da[19] 7 recessive lethal"
p142L: Add entry "da[20] 7 recessive lethal"
p142L, da table footnote: Add entry "7 = Grigliatti."
p142L, da cytology: Change to "Placed in 32A by fine-structure
deficiency analysis of region 31A-32A by Grigliatti et al."
p183R: E(Sd)> E(SD)
p201R, err alleles: Add entry "err[2] - err[4] also isolated."
p201R, err cytology: Change to "Placed in 31E by fine-structure
deficiency analysis of region 31A-32A."
p249R, Gbeta13F location: 2-{54}> 2-{51}
p255L: Add entry "Glucose-tasting-defective: see Gtd."
p255L: Add entry "Glutamic acid decarboxylase: see Gad."
p259R: Add entry "grh, grainy head: see Ntf."
p259R: Add entry "groggy: see ggy."
p268L, H references: Add entry "Plunkett, 1926, J. Exp. Zool. 46:
181-244."
p268L, H references: Add (after "Development") "111: 89-104."
p268R, H[17] (in table): Add entry "gamma ray Posakony/Groger"
p268R, H[18] (in table): Add entry "gamma ray Posakony/Groger"
p268R, H[19] (in table): Add entry "gamma ray Posakony/Groger"
p268R, H[20] (in table): Add entry "gamma ray Posakony/Groger"
p268R, H[21] (in table): Add entry "gamma ray Posakony/Groger"
p268R, H[21] (in table): H[C]> H[C23]
p268R, H[22] (in table): Add entry "gamma ray"
p268R, H[22] (in table): Bang> Posakony
p268R, H[22] (in table): H[C]> H[RP1]
p268R, H[26] (in table): Add entry "X ray."
p288L, inC alleles: InC[1] - InC[3]> inC[1] - inC[3]
p309L (in l(1)2A table): l(1)2Af (bold face)> l(1)2Af (regular)
p309L (in l(1)2A table): sta> sta (bold face)
p509R, nod references: Genetics (submitted)> Genetics 125:115-27.
p555L, pn: awk[K]> awd[K] (appears twice)
p555R, pn: awk[K]> awd[K] (appears four times)
p570R, qua: Nsslein-> Nusslein (diaeresis over the u)
p570R, qua: f2qua[2] - qua[7]> qua[2] - qua[7] (in italics)
p621L: Add entry "scabrous> sca"
p621L: Add entry "shaven baby> sv"
p740R: For the entry unk, see the CYTOGENETIC MAP, p1132.
p1067: change figure explanation to "the third row shows the N-
banding pattern (provided by Pimpinelli, Bonaccorsi,
Dimitri, and Gatti.)."
p1068L: Change reference for figure explanation to "(Pimpinelli,
Bonaccorsi, Dimitri, and Gatti)."
p1069L: Change reference for figure explanation to "(Pimpinelli,
Bonaccorsi, Dimitri, and Gatti)."
p1069R (upper): Change reference for figure explanation to
"(Pimpinelli, Bonaccorsi, Dimitri, and Gatti)."
p1069R (lower): Change reference for figure explanation to
"(Pimpinelli, Bonaccorsi, Dimitri, and Gatti)."
Notes appended to Redbook by attendees at the Philadelphia fly
meeting:
exo: exocephalon is allelic to phm: phantom (Eberl)
mat(2)N mutations are hypomorphic alleles of l(2)31Ei
Sryc likely to correspond to wdn (Lepesant)
fs(1)A107 renamed brn: braniac (can't read signature)
fs(1)1621 renamed snf: simply not fertile (Saltz)
Kin: Kinesin should be Khc: Kinesin heavy chain (Saxton)
l(1)3Ac renamed trol: troll by Datta and Kandel {not l(1)trol as
they suggest}
l(3)73Ab will be named soon (Andrew)
l(3)85Ee renamed hyd: hyperplastic discs (Shearn)
l(3)SG29 renamed md: minidiscs (Shearn)
l(3)SG56 renamed qrt: quartet (Shearn)
New genes inserted into list by participants:
Chc: Clathryn heavy chain
dco: discs overgrown (see Developmental Biology 140: 413-429)
Gprk1
Gprk2
Pra: Paramyosin
rdgC: retinal degeneration C
tsh: teashirt
A change that we suggest:
ms(3)sa should be sa: spermatocyte arrest
Symbols used by Ashburner that I prefer over ours:
l(1)17Aa through l(1)17Ad instead of l(1)16Fa through l(1)16Fd
LanA, LanB, and LanC instead of Lam-A, Lam-B, and Lam-C
Pk17C instead of Pk?4
Pk45C instead of Pk?3
Pk53C instead of Pk?7
Pk64F instead of Pk?6
Pk91C instead of Pk?2
Other new synonymy:
Pkc2 is the same as inaC
sbl mutations are allelic to para
*** DIN 9
DROSOPHILA INFORMATION NEWSLETTER
Volume 10, April 1993
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news/din or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 10
To add your name to the Newsletter distribution list, send one of
the following E-mail messages.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail if you have
successfully signed on to the list. If you are on the list and do
not wish to receive DIN, or you want to remove a defunct address,
replace SUB in the above message with UNS. The SUB command can
also be used to correct spelling errors in your real name; the
new entry will simply replace the old as long as it was sent from
the same USERID@NODE address.
*** DIN 10
DIN Vol. 10 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Network Discussion Group for Drosophila
>European Drosophila Research Conference
>Bloomington Stock Center Closed
>DATABASES/COMPUTING
>Gopher for FlyBase
>GENETIC NOTES
>Updates and corrections to the Redbook
*** DIN 10
ANNOUNCEMENTS
DROSOPHILA NEWSGROUP ON BIOSCI
A BIOSCI/Bionet newsgroup for discussion of Drosophila
biology has been proposed. At this writing, the vote is not yet
complete. The following assumes that sufficient YES votes will be
received by BIOSCI to establish the group. The DROSOPHILA group
will not replace the DIN mailing list at present, but a copy of
each DIN issue will be posted to this group, so that you can read
it via Usenet should you prefer. It is hoped that this newsgroup
will foster more active discussion of Drosophila research methods
and materials. A newsgroup with similar orientation for
Arabidopsis researchers is quite successful in meeting needs of
rapid information exchange between labs on methods, materials and
questions of scientific interest in this area. Michael Ashburner,
Dept. of Genetics, U. of Cambridge, Cambridge, England
(MA11@GEN.CAM.AC.UK), will serve as the Discussion Leader and be
"responsible for ensuring a reasonable level of activity". The
name of the group will be bionet.genome.drosophila (on Usenet) or
bionet.drosophila or DROSOPHILA (on mailing lists). Discussions
of non-genetic as well as genetic aspects of Drosophila are
encouraged.
If you are not a current reader of these BIOSCI/Bionet
newsgroups, here are some instructions for starting out. Please
*DO NOT* send requests for newsgroup subscriptions or information
about BIOSCI/Bionet to the DIN editors - we cannot help you. You
MUST direct your requests to BIOSCI at the addresses provided
below.
New users of BIOSCI/bionet may want to read the "Frequently
Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides
details on how to participate in these forums and is available
for anonymous FTP from net.bio.net [134.172.2.69] in
pub/BIOSCI/biosci.FAQ. It may also be requested by sending e-mail
to biosci@net.bio.net (use plain English for your request). The
FAQ is also posted on the first of each month to the newsgroup
BIONEWS/bionet.announce immediately following the posting of the
BIOSCI information sheet.
Most of the following information is from the BIOSCI
ELECTRONIC NEWSGROUP NETWORK INFORMATION SHEET for the Americas
and Pacific Rim countries. If you are located in Europe, Africa,
or Central Asia, please request that version of the BIOSCI
information sheet by sending e-mail to the Internet address:
biosci@net.bio.net.
Introduction: The BIOSCI newsgroup network was developed to
allow easy worldwide communications between biological scientists
who work on a variety of computer networks. By having
distribution sites or "nodes" on each major network, BIOSCI
allows its users to contact people around the world without
having to learn a variety of computer addressing tricks. Any user
can simply post a message to his/her regional BIOSCI node and
copies of that message will be distributed automatically to all
other subscribers on all of the participating networks, including
the Internet, USENET, BITNET, EARN, NETNORTH, HEANET, and JANET.
E-mail Subscription Requests and other Information: If you
need to receive BIOSCI messages by e-mail, please send all
subscription requests, subscription cancellations, or any other
questions about using BIOSCI to the Internet address:
biosci@net.bio.net (Americas & Pacific) or biosci@daresbury.ac.uk
(Europe). As your request will be read by a human, there is no
need for special syntax in your message. Simply state the name of
the newsgroup to which you would like to subscribe.
Please be sure to use the biosci address above and **DO
NOT** request subscriptions by posting messages to the newsgroup
mailing addresses. Posting to the newsgroup addresses sends
copies of your request to hundreds of people around the world and
wastes network resources. PLEASE NOTE THAT IF YOU HAVE ACCESS TO
USENET NEWS YOU DO NOT NEED AN E-MAIL SUBSCRIPTION!! Simply read
and post to the newsgroups in the "bionet" newsgroup hierarchy
using your USENET news software (e.g., readnews, rn, vnews, ANU-
NEWS, postnews).
All interested users are strongly encourage to explore
getting usenet news software at your site. The software is in the
public domain, and you will find it much more convenient than
subscribing to newsgroups by e-mail. Please consult your systems
manager or contact biosci@net.bio.net for assistance if needed.
Canceling E-mail Subscriptions: If you have subscribed to a
newsgroup and are now leaving an institution or changing your e-
mail address, it is IMPERATIVE that you send a note to
biosci@net.bio.net and cancel your subscription! Non-existent
addresses or overflowing mailboxes cause computer mail programs
to send back "daemon" messages which might bother everybody on
the newsgroup. We will immediately remove any address causing
such a problem, but would prefer it if you would notify us in
advance as a courtesy to the rest of the user community. (The DIN
editors would greatly appreciate the same courtesy. Please see
instructions at the beginning of this issue for unsubscribing to
DIN).
Posting Messages to Newsgroups: Messages can either be
posted into the USENET newsgroups using "postnews" or similar
software or they can be submitted by electronic mail. To post a
message to the Drosophila group by e-mail send your message to
dros@net.bio.net (Americas, Asia, Pacific) or
dros@daresbury.ac.uk (Europe and Africa). Messages to the
Drosophila group will be posted directly to the newsgroup without
editorial intervention.
USENET users who use the "postnews" or similar software on
their local computer should be sure to set the message
distribution to "world" or "bionet" or else your message may not
be distributed beyond your local computer. USENET newsgroups are
read using, e.g., the "readnews," "rn," or "vnews" software on
UNIX systems. USENET news software is in the public domain and is
available for most UNIX systems. A public domain USENET news
software package named ANU-NEWS is also available for VAX/VMS
systems. Your local BIOSCI node can point you towards acquiring
the software for use on your computer system.
*** DIN 10
EUROPEAN DROSOPHILA RESEARCH CONFERENCE
We would like to remind all interested drosophila workers
that the deadline for registration for the 13 European Drosophila
Research Conference was Monday, March 15. Those of you who forgot
to register have still the opportunity to do so at the regular
fee, if we get the complete registration by April 5. Participants
of the us fly meeting can register there by giving the
registration form and a checque for the conference fees to Dr.
Michael Ashburner. The complete registration package can be
obtained by requesting it from: FLIES@GRIMBB.BITNET or
FLIES@MYIA.IMBB.FORTH.GR or from Michael at San Diego.
Registration Fees (in US$)
BEFORE APRIL 5 AFTER APRIL 5
DR SR DR SR
Regular 725 (480) 850 (665) 900 (665) 1150 (790)
Student 600 (400) NA 790 (480) NA
Accompanying 545 (360) NA 665 (400) NA
Person
Figures in brackets: Minimum Down Payment DR: Double Room SR:
DR Single Occupancy
WE HOPE TO SEE YOU IN CRETE -- KITSOS LOUIS.
*** DIN 10
STOCK CENTER CLOSED
The Bloomington Stock Center will be closed the week of
March 29th. Orders placed between 12:00 noon on March 25 and noon
on April 8 will be shipped on April 12. We hope to see you in San
Diego.
*** DIN 10
DATABASES/COMPUTING
GOPHER ACCESS TO FLYBASE
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47405. 812-855-5782, FAX/2577, MATTHEWK@INDIANA.EDU.
The easiest way to access FlyBase is with Gopher. For those
of you who haven't heard of Gopher yet, the following excerpts
from "GOPHER DIGS THROUGH THE INTERNET FOR YOU" by Eric Schlene,
which appeared in UCS Monitor, Volume 4, Number 2 (March 15,
1993), published by University Computing Services, Indiana
University, should be useful.
-----------------------------------------------------------------
"Developed at the University of Minnesota, Gopher is a network
navigation tool. The name "Gopher" conveys much about the
technology. If you need something off the network, let Gopher "go
for" it. Gopher will burrow through the network to retrieve what
you asked for.
Like its mammalian namesake, Gopher is hardy and aggressive.
It can adapt to a variety of computing environments and has a
world-wide range. Gopher servers, computers where Gopher goes to
find files, are popping up all over the globe. Known collectively
as "Gopherspace," these servers offer information and services
you can access over the Internet.
How Gopher works: Like many new applications, Gopher is a
client/server product. The client part runs on your computer
(e.g., PC, Mac, UNIX workstation). And the server part runs on
computers elsewhere on the Internet. At your command, your client
'opens electronic tunnels,' finding the computers where the
goodies you want are stored.
If you like to explore electronically, you're going to love
Gopher. There are countless links to libraries, computing
centers, universities, corporations, and organizations all over
the world. The only hard part about using Gopher is quitting!"
-----------------------------------------------------------------
You may also find the README file provided by the developers
of Gopher to be helpful:
-----------------------------------------------------------------
In this directory are subdirectories containing the current
versions of internet Gopher clients and servers. Unfortunately,
there is minimal documentation for the software; but have faith,
we are working on it.
The internet Gopher uses a simple client/server protocol
that can be used to publish and search for information held on a
distributed network of hosts. Gopher clients have a seamless view
of the information in the gopher world even though the
information is distributed over many different hosts. Clients can
either navigate through a hierarchy of directories and documents
-or- ask an index server to return a list of all documents that
contain one or more words. Since the index server does full-text
searches every word in every document is a keyword.
If you want to test a gopher client without setting up your
own gopher server you should configure the client to talk to
'gopher.micro.umn.edu' at port 70. This will allow you to explore
the distributed network of gopher servers at the University of
Minnesota. You can try the Unix client by telneting to
consultant.micro.umn.edu and logging in as 'gopher'.
If you decide to run a gopher server and would like it to
appear in the list of 'other gophers' at gopher.micro.umn.edu
send an e-mail to gopher@boombox.micro.umn.edu and we will add
your gopher to the list of gophers.
Bug reports, comments, suggestions, etc. should be e-mailed
to the Gopher development team at: gopher@boombox.micro.umn.edu
-----------------------------------------------------------------
If you don't have access to a Gopher client, ask your local
computing support center to help you get set up. The Gopher
client software is available by anonymous ftp from
boombox.micro.umn.edu, in the directory /pub/gopher/, or from
ftp.bio.indiana.edu, in the directory /util/gopher/. FlyBase is
accessible from the Gopher hole at Indiana (IUBio) and most of
the files (but not those from the Redbook) are also accessible
from the Gopher hole at the Biozentrum in Basel. It may be
convenient, if your main use of Gopher is to search FlyBase, to
set up your Gopher client so that access to Indiana or Basel is
the default. The link to add to your Gopher server to tunnel to
Indiana is:
Name=IUBio Biology Archive, Indiana University
(experimental)
Type=1
Port=70
Path=1/
Host=ftp.bio.indiana.edu
The link for the Basel Biozentrum host is:
Name=bioftp EMBnet Switzerland (experimental)
Type=1
Port=70
Path=
Host=bioftp.unibas.ch
Services on the IUBio Gopher host are also available using
WAIS client software. WAIS is the Wide Area Information System.
Client software is available for a variety of computer platforms
by FTP from IUBio (in the directory /util/wais) and
ftp.think.com.
The WAIS source for the Indiana archive (IUBio) is:
(:source
:version 3
:ip-address "129.79.224.25"
:ip-name "ftp.bio.indiana.edu"
:tcp-prot 210
:database-name "INFO"
:cost 0.00
:cost-unit none
:maintainer "archive@bio.indiana.edu"
:description "
Once you reach FlyBase with Gopher you can copy files to
your local machine or you can search files interactively. The top
FlyBase menu will look like this on your screen:
Internet Gopher Information Client v1.00
Flybase
--> 1. About Flybase [14Jan93, 5kb].
2. --------------------------------------------/
3. Genes/
4. Functions/
5. Aberrations/
6. Clones/
7. Maps/
8. Sequences/
9. --------------------------------------------/
10. People/
11. Stocks/
12. Miscellany/
13. --------------------------------------------/
14. Documents/
15. News/
16. References/
17. Working papers/
18. Allied fly data/
19. Redbook (Genome of Drosophila)/
When you choose a topic a new menu of subtopics and/or
available files will be displayed. Choosing a file from a Gopher
menu returns the file to your local machine. Menu items ending
with <?> allow you to search that part of the database for
specific information. Gopher searches are supported for the
topics Genes, Clones, People, Stocks, News (back issues of DIN),
Allied fly data, and Redbook.
Gopher is able to retrieve information very rapidly because
it searches indexes of the data files. Any file can be retrieved
with Gopher, but only files that have been indexed for Gopher's
use can be searched with Gopher. Indexes based on standard rules
of English did not work well for Drosophila nomenclature, as
those of you who tried to find stocks with the original IUBio
Gopher server discovered. Don Gilbert has modified the indexing
rules of the IUBio Gopher so that Drosophila genotypes can be
more effectively searched. There are still a few bugs in the
system, but you will find it significantly improved. Plain
language queries work well for retrieving information from most
of FlyBase, but some tricks are helpful when searching the stock
lists. The following information should help you construct an
effective query.
* An asterisk (*) serves as a wild card when placed at the end
of a character string. Wild cards cannot precede or be imbedded
in a character string.
* Word delimiters are: -/{}:.~*";,|. These symbols will not be
recognized as literal characters in a search string.
* Stock numbers are preceded by a pound sign (#) in all of the
lists used by Gopher.
* All of the stock lists used by Gopher mark superscripts with
brackets ([]).
* All cytological map positions are entered in the database
with three digit division numbers and two digit band numbers so
that these alphanumeric items will sort numerically. For example,
67C4-6 is recorded as 067C04-06, and 3C2 as 003C02. Cytological
information is available for Bloomington stocks only at present.
Gopher search software is still under development and is not
always accurate when searching on cytological locations.
* Examples:
To find a stock by its stock number precede the number with
the pound sign (e.g., #617) for Bowling Green stocks, Umea
stocks, and stocks from the main collection at Bloomington.
Precede the stock number with #P (e.g., #P43) for transposon
stocks from Bloomington.
To find all available alleles of a gene, type the gene
symbol followed by * (e.g., lt*). To find a specific allele, type
the gene symbol followed by the superscript in brackets (e.g,
lt[14]).
In theory, you should be able to find all stocks with
breakpoints in a given division by asking for the three digit
division number followed by * (e.g., 084*). Add the subdivision
letter (e.g., 084B*) to find all breakpoints within a given
subdivision. In practice, the subdivision queries sometimes turn
up stocks not identified by the division-only query. Until we
sort this out, you must do 7 sequential searches to find all
relevant stocks (e.g., 084*, 084A*, 084B*, 084C*, 084D*, 084E*,
084F*).
Most published P stocks available from Bloomington can now
be found by searching for the laboratory acquisition name (e.g.,
ms(3)neo6, A146.3M3, l(3)A344.1M3, B12-3-5, l(3)B9-3-53). Stocks
carrying specific constructs can be found by searching for the
construct abbreviations, such as lacW, lArB, pW8, A92, or Car20,
although this search may also turn up stocks that contain
modified versions of the desired construct.
As with rearrangements in the main collection, cytological
map positions for insertions are entered as three digit division
numbers and two digit band numbers. To find all inserts in 32D,
ask for 032D*. For now, find all inserts in 32 by searching for
032*, plus each subdivision (032A*, 032B*, etc.) as described
above.
*** DIN 10
GENETIC NOTES
CORRECTIONS FOR THE REDBOOK
p=page, L=left, R=right
p 296L: Kin : Kinesin to Khc: Kinesin heavy chain
p 296L, Khc : Add entry " cytology: Located in 52F10-11."
p 296L, Khc : Remove " discoverer: Christensen."
p 296L, Khc phenotype: Kin to Khc
p 621L, Add entry "scabrous: : see sca"
p 626L, Sdh1 (table): de Jong to Lawrence
p 638R, shaven : svb to sv
p 659L, alphaSpec : Add entry "synonym: l(3)62Bd"
p 660R, spire : spi to spir
p 660R, Add entry "spitz : see spi"
p 779R, wg[l-14] table comments: Add entry "P-element insert"
p 779R, wg molecular biology: Omit wg[l-18]
p 779R, wg molecular biology table: Add entry below wg[1]
"wg[l-14] located at origin of molecular map"
p 935R, In(2L)wg[P]: Omit "synonym: In(2L)wg[P] "
p 1051L, Tp(2;Y)L12 table cytology: 41A;43E to 41A;43A
p 1051L, Tp(2;Y)R70 table ref : 1,3 to 1
p 2618: T(Y2)A111 = T(Y;2)h14;028D
p 2634: T(Y;2)B66 = T(Y;2)Xhy[+];028C
p 2637: T(Y;2)B104 = T(Y;2)B[S]Xh;028D
p 2763: T(Y;2)R50 = T(Y;2)h1-2;028B
In addition, in The Genome of Drosophila melanogaster, we have
ceased superscripting YL and YS to conform to usage for the
autosomes; thus, YSX.YL, etc. -- Dan Lindsley and Georgianna
Zimm, Dept. of Biology, U. of California, La Jolla, CA 92093.
619-534-3109, FAX/0053, REDBOOK@JEEVES.UCSD.EDU,
ZIMM@JEEVES.UCSD.EDU.
The table at the top left of p. 381 contains numerous
mistakes. A new, corrected table appears below. a=alpha in aSpec.
genetic cytologic included excluded
locus location location in from synonym
l(3)62Ba 3-{1.5} 62B2-9 Df(3L)R-R2 Df(3L)R-G7 l(3)dre1
l(3)62Bb 3-{1.5} 62B2-9 Df(3L)R-R2 Df(3L)R-G7 l(3)dre9
l(3)62Bc 3-{1.5} 62B2-9 Df(3L)R-R2 Df(3L)R-G7 l(3)dre2
l(3)62Bd 3-{1.5} 62B2-9 Df(3L)R-R2 Df(3L)R-G7 l(3)dre3
l(3)62Be 3-{1.5} 62B2-9 Df(3L)R-E Df(3L)R-G7 l(3)neo7,
aSpec
R 3-1.4 62B Df(3L)R-E Rap1
l(3)62Bf 3-{1.5} 62B8-12 Df(3L)R-E l(3)dre4
l(3)62Bg 3-{1.5} 62B8-12 Df(3L)R-E l(3)dre5
l(3)62Bh 3-{1.5} 62B11-C1 Df(3L)R-E Df(3L)R-G2 l(3)dre6,rbd
l(3)62Bi 3-{1.5} 62B11-C1 Df(3L)R-E Df(3L)R-G2 l(3)dre7
l(3)62Ca 3-{1.5} 62B12-D1 Df(3L)R-G5 Df(3L)R-E l(3)dre8
l(3)62Da 3-{1.5} 62C4-D5 Df(3L)R-R2 Df(3L)R-G5 l(3)dre10
l(3)62Db 3-{1.5} 62C4-D5 Df(3L)R-R2 Df(3L)R-G5 ecd
-- Jim Mason, NIEHS, P.O. Box 12233, Research Triangle Park, NC
27709-2233. 919-541-4483, FAX/4704, MASON_J@VAXE.NIEHS.NIH.GOV.
p 34 (table), Antp[Ns-rv2]: In(3R)81F;90BC to T(3;4)84B1-3;102F
p 34 (table), Antp[Ns-rv72]: Df(3R)84B3;84D to In(3R)84B3;84D
-- Paul Talbert, Basic Sciences M684, Hutchinson Cancer Research
Center, 1124 Columbia St., Seattle, WA 98104. 206-667-4509,
FAX/5889.
*** DIN 10
DROSOPHILA INFORMATION NEWSLETTER
Volume 11, July 1993
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 11
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail if you have
successfully signed on to the list. If you are on the list and do
not wish to receive DIN, or you want to remove a soon-to-be-
defunct address, replace SUB in the above message with UNS. The
SUB command can also be used to correct spelling errors in your
real name; the new entry will simply replace the old as long as
it was sent from the same USERID@NODE address.
*** DIN 11
DIN Vol. 11 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>1994 National Drosophila Conference
>Recent additions to FlyBase
>Bloomington Stock Center News
>REQUESTS FOR MATERIALS
>Inserts or lethals in 17AB
>Df(3L)Mg
>ms(2)E8 and ms(2)E9
>Documents for Drosophila thesaurus
>DIS 1-33
>MATERIALS AVAILABLE
>Chromosome 3 homozygous-by-descent lines
>TECHNICAL NOTES
>Double-sided sticky tape for embryo injections
>Cryopreservation of Drosophila embryos
>Materials from the Drosophila Genome Center
>GENETIC NOTES
>Updates and corrections to the Redbook
*** DIN 11
ANNOUNCEMENTS
DROSOPHILA CONFERENCE
The 1994 National Drosophila Conference will be held April
20-24, 1994 in Chicago, Illinois. Victoria Finnerty, Emory
University, is the meeting organizer. Send suggestions for the
1994 conference format to VICTORIA@BIOLOGY.EMORY.EDU.
*** DIN 11
RECENT ADDITIONS TO FLYBASE
*A major new FlyBase product has been released to the
FlyBase server at Indiana, and is available either by Gopher (in
Flybase/References) or by ftp (in flybase/refs directory). It is
a unified list of publications concerning Drosophila. Drawn from
a variety of sources (described in references-sources.txt) it
includes 51552 entries, from 1684 to 1993. All are full
references with as complete bibliographic information as is
available.
You can search this reference list via Gopher. The reference
file is available in a few formats including refer, as readable
by many bibliographic programs including Endnote, Pro-Cite and
Refer, and comma-separated-values (csv) as used by many
spreadsheet and database programs.
It is impossible that this file is either 'complete' or free
of errors. Mail flybase-refs@morgan.harvard.edu with additions
and corrections.
* The stock list of the National Drosophila Species Resource
Center at Bowling Green is now available on FlyBase. Three
versions of the list are posted: 1) species-center.rtf contains
the center's catalogue in rich text format, which retains
formatting information from the original word-processing file
provided by the stock center. If you have a word processing
program that handles rtf you can print a copy of the center's
catalogue from this file; 2) species-center.txt is a
database/spreadsheet format file; 3) species-center.rpt is a file
in report format more easily read by humans than the txt file
(when searching the stock list with gopher, information from this
report file is returned). See the document species-center.doc for
further information about the species stock center and these
files. All of these files are in the directory
flybase/stocks/stock-centers.
*** DIN 11
BLOOMINGTON STOCK CENTER NEWS
*The Bloomington Stock Center will be closed the week of
September 13, 1993. Requests received by noon CDT on September 9
will be shipped as usual on the 13th. Orders placed between noon
on the 9th and noon on the 23rd will be shipped on September 27.
Please plan accordingly.
*Second chromosome lethal P-inserted stocks from the
Drosophila Genome Center will soon be available. Third chromosome
inserts should be available sometime this fall. Less well
characterized insertion strains or those containing less
versatile constructs will be discarded at some point in favor of
the new stocks. Individuals who contributed the stocks will be
notified personally before stocks are discarded and a list of all
stocks to be discarded will be posted on the BIOSCI/Bionet
Drosophila newsgroup (see DIN Vol. 10) six weeks before stocks
are to be discarded. Discard lists will also be posted on FlyBase
in the file stock-center-news.doc in the directory
flybase/stocks/stock-centers/bloomington. If you would like to
receive a copy of stocks on the discard list please order them as
soon as possible after the list is made public.
*HAVE YOU MOVED? If you have a new mailing address please
EXPLICITLY state this when you order stocks, or let Kathy know as
soon as you move so our files can be updated. Address labels are
generated by computer from our master address file and are not
checked individually against each order. Flies sent to the wrong
address create delays for you and extra work for us so please
help us keep our records current.
*** DIN 11
REQUESTS FOR MATERIALS
INSERTS OR LETHALS IN 17AB
Lee Fradkin, Nusse Lab, HHMI, CMGM B269, Stanford Medical Center,
Stanford, CA 94305. FRADKIN@CMGM.STANFORD.EDU.
We would appreciate strains or information about strains
with enhancer traps or lethals that map to the 17AB region.
Thanks.
*** DIN 11
DEFECIENCY
Rob Jackson, Worcester Foundation for Experimental Biology, 222
Maple Ave., Shrewsbury, MA 01545. JACKSON@SCI.WFEB.EDU.
I'm looking for Df(3L)Mg27 produced by Mglinetz. I would
appreciate hearing from anyone who has this deficiency or knows
of its whereabouts.
*** DIN 11
MALE STERILES
Peter Clyne, Dept. of Biology, Yale U., PO Box 6666, New Haven CT
06511, USA. 203-432-3542, Fax/5631, DRONGO@VENUS.CIS.YALE.EDU
I am seeking ms(2)E8 and ms(2)E9 flies which were first
isolated by Edmonson in 1951. Both flies and information about
whom to contact directly for the flies would be deeply
appreciated. Thank you.
*** DIN 11
MATERIAL FOR FLY THESAURUS
Joanne Martinez, U. of Arizona School of Library Science/Dept.
Management Information Systems. JPMARTIN@CCIT.ARIZONA.EDU
Our group is developing an automatic thesaurus for the
Drosophila research community. We are gathering "object filters"
(gene names, protein function names, researcher names, technique
names, subjects and other keywords), as well as full text
electronic documents for cluster analysis (semantic
relationships). The flybase and online Redbook have been very
helpful for the former, but we need more electronic full text
documents for determining relationships between words.
I ask your assistance in providing us with a wide range of
full text documents in *electronic* format, particularly
abstracts and review-type articles. This is important, so that
the terms in our thesaurus are as rich as possible, i.e. that the
thesaurus covers as much of the terminology used in Drosophila
research as possible.
The documents will *not* be used for their intellectual
content, so there is no problem with copyright. We are only
interested in the terms and their relationships to one another.
The documents will be erased once we have extracted the objects
and conducted the cluster analysis.
Please send whatever files you can to: jpmartin@ccit.arizona.edu
Thank you very much.
*** DIN 11
BACKISSUES OF DIS
Kathy Matthews, Dept. of Biology, Indiana U., Bloomington, IN
47401. 812-855-5782, FAX/2577, MATTHEWK@INDIANA.EDU
The Bloomington Stock Center would like to obtain a complete
set of Drosophila Information Service. We have all volumes from
number 34 to the present. If you have any of the earlier issues
that you are ready to part with we would be very happy to give
them a good home.
*** DIN 11
MATERIALS AVAILABLE
CHROMOSOME III HOMOZYGOUS BY DESCENT LINES
Ananias Escalante and Francisco Ayala, Dept. Ecology and
Evolutionary Biology, U. of California, Irvine, CA 92717.
FAYALA@ORION.OAC.UCI.EDU, AESCALAN@DARWIN.BIO.UCI.EDU
We are currently developing around 400 lines of D.
melanogaster homozygous by decent at the chromosome III using the
lethal balanced TM3 strain. These flies were collected in
northern California as part of a project directed to study
polymorphism in natural populations. The lines were started with
males collected directly from the field. If any person is
interested in these lines please contact us. These lines will be
discarded after we finish our project.
*** DIN 11
TECHNICAL NOTES
DOUBLE-SIDED STICKY TAPE FOR EMBRYO INJECTIONS
Mary Whiteley and Judith A. Kassis, Food and Drug Administration,
8800 Rockville Pike, Bethesda, Maryland, 20892. 301-496-9309, FAX
/4684, KASSIS@HELIX.NIH.GOV
One of the most common problems associated with
microinjection of Drosophila embryos is the toxicity of different
batches of double-sided sticky tape. Recently, we have found that
batches of 3M double-sided tape purchased at our local grocery
stores is often toxic to embryos. This is evident the morning
after microinjection with the embryos being noticeably caved in
and hollow. We called the 3M company to see if they manufactured
alternate kinds of double-sided tape, and the reply was yes....
some 200 kinds. We then spoke with someone in the 3M testing
laboratory about which of these 200 kinds of tape was likely to
be the least toxic. She sent us a sample of industrial double-
sided stick tape that had been rigorously tested for toxicity (to
what we are not sure). This tape is an acetate based tape (type
415, 1/4"). We obtained a trial sample of the tape and, in our
hands, and others on the NIH campus, this tape is virtually non-
toxic to Drosophila embryos - we now routinely obtain about five-
fold more hatching larvae than before. We have not rigorously
tested this tape versus the tape at the grocery stores, nor have
we tried different batches of the tape, but we think that it is
important to inform Drosophilists of our success so that others
may hopefully benefit. Unfortunately, 3M does not supply this
tape directly, so you must first call 3M to locate the
distributor in your area (612-733-1110; ask for product
information). Some distributors are reluctant to sell you less
than 1 case (144 rolls). Although I have contacted some that will
split up a case, the cost of a 36 yard roll is about $8.00 versus
$3.00 a roll bought by the case.
*** DIN 11
AVAILABILITY OF MATERIALS FROM THE DROSOPHILA GENOME CENTER
Gerald M. Rubin, Dept. of Molecular and Cellular Biology, Life
Science Annex Bldg., Box 539, U. of California, Berkeley, CA
94720. 510-643-9945, FAX /9947, FLYGENOME@MAILLINK.BERKELEY.EDU
The following is an excerpt from a text document now
available on FlyBase, P1.doc - further information, as well as
the list of P1 clones, are available on FlyBase.
The overall goal of the Center, that was funded by the NIH for
three years starting August 1, 1992, is to build an integrated
physical, genetic, and cytogenetic map of the Drosophila genome
based on STS content mapping. We hope that the data we generate
as the map is gradually assembled will be useful and widely
available to Drosophila workers. In return, we ask for your help
in bringing any errors, inconsistencies or independent
confirmations of the data contained in these tables to our
attention. Such feedback will improve the quality of the final
map and speed its completion. Correspondence can be sent by email
to flygenome@maillink.berkeley.edu or by FAX to 510-643-9947;
alternatively correspondence can be directed to specific members
of the Center as outlined below.
The generation of the data described in this database is
supported by a Drosophila Genome Center Grant from the NIH (NIH
grant HG00750, Principal Investigator Gerald M. Rubin; Co-
Investigators: Daniel Hartl, Christopher Martin, Michael
Palazzolo, and Allan Spradling), by the Howard Hughes Medical
Institute through its support of the Rubin and Spradling
laboratories and by the DOE through its support of the LBL Human
Genome Center, the home of the Palazzolo and Martin laboratories.
Please acknowledge the Drosophila Genome Center in publications
using this information; additional acknowledgments that apply to
specific subsets of the data are detailed below.
In addition to these data tables two types of materials are being
made available to the Drosophila community: Clones of D.
melanogaster DNA in the P1 vector and fly stocks carrying mapped
single P element insertions that inactivate a vital gene. All
clones, fly stocks and other information may be used for research
purposes without restriction.
The average insert size in the P1 library is about 80kb. The
following 16 laboratories have volunteered to store the 9,216
arrayed clones that comprise the basic P1 library (approximately
5-hit) and to make them available to other laboratories in their
geographical areas. They are not being financially compensated
for their effort and we all owe them our appreciation.
Sean Carroll, University of Wisconsin-Madison, Howard Hughes
Medical Institute, Laboratory of Molecular Biology, 1525 Linden
Drive, Madison, WI 53706, Tel: 608-262-3203, Fax: 608-262-4570
Allan Spradling, Carnegie Institute Washington, Howard Hughes
Medical Institute, Department of Embryology, 115 West University
Parkway, Baltimore, MD 21210, Tel: 410-554-1221, Fax:
410-243-6311
Hugo Bellen,Baylor College of Medicine, Howard Hughes Medical
Institute, One Baylor Plaza, Room T634, Houston, TX 77030, Tel:
713-798-5272, Fax: 713-797-6718
Steven Henikoff, Fred Hutchinson Cancer Research Center, Howard
Hughes Medical Institute, Department of Genetics, Room A1-111,
1100 Fairview Avenue North, Seattle, WA 98109, Tel: 206-667-4514,
Fax: 206-667-5889
Thomas C. Kaufman, Indiana University, Howard Hughes Medical
Institute, Department of Biology, Jordan Hall, Room A-507, Third
Street and Faculty, Bloomington, IN 47405, Tel: 812-855-3033,
Fax: 812-855-2577
S. Larry Zipursky, University of California at Los Angeles,
HHMI/5-748 MacDonald Bldg., 10833 Le Conte Avenue, Los Angeles,
CA 90024-1662, Tel: 310-825-2834, Fax: 310-206-3800
Carl Thummel, University of Utah, Howard Hughes Medical
Institute, Department of Human Genetics, Eccles Institute of
Human Genetics Bldg. 533, Room 2100, Salt Lake City, UT 84112,
Tel: 801-581-2612, Fax: 801-581-5374
Tsuneyuki Yamazaki, Department of Biology, Faculty of Science,
Kyushu University, Fukuoka 812, Japan, Tel: (81)-92-641-1101,
Fax: (81)-92-632-2741
Michael Ashburner, Department of Genetics, Cambridge University,
Downing Street, Cambridge CB2 3EH, England, Tel: (44)-223-333969,
Fax: (44)-223-333992
Spyros Artavanis-Tsakonas, Yale University, Howard Hughes Medical
Institute, Boyer Center for Molecular Medicine, 295 Congress
Avenue, New Haven, CT 06536-0812, Tel: 203-737-4466, Fax:
203-787-3364
Gary H. Karpen, Salk Institute, Department of MBVL, PO Box 85800,
San Diego, CA 92186-5800, Tel: 619- 453-4100, X473, Fax:
619-457-4765
Gerald M. Rubin, University of California at Berkeley, Howard
Hughes Medical Institute, Department of Molecular & Cell Biology,
Room 539 LSA Bldg., Berkeley, CA 94720, Tel: 510-643-9945, Fax:
510-643-9947
Daniel L. Hartl, Harvard University, Department of Organismic &
Evolutionary Biology, 16 Divinity Avenue, Cambridge, MA 02138,
Tel: 617-496-3917, Fax: 617-496-5540
Matthew Scott, Stanford University School of Medicine, Department
of Developmental Biology, Beckman Center, B300, Stanford, CA
94305-5427, Tel: 415-725-7680, Fax: 415-723-9878
Paul Lasko, McGill University, Department of Biology, 1205 Ave
Docteru Penfield, Montreal, PQ H3A 1B1, Canada, Tel:
514-398-6721, Fax: 514-398-5069
Marek Mlodzik, European Molecular Biology Laboratory,
Differentiation Programme, Meyerhofstr. 1, D-6900 Heidelberg,
Germany, Tel: (49)-62-21-387-303, Fax: (49)-62-21-387-306
Drosophila stocks carrying mapped single P element lethal
insertions are being deposited in the Bloomington Drosophila
Stock Center. The first 500 lines will be available this summer
or fall. More details on the P element lines will appear on
FlyBase when the stocks are available.
CONSTRUCTION AND REPLICATION OF THE P1 LIBRARIES.
The two P1 libraries we are using were constructed by David
Smoller in the Hartl laboratory. Source material for the P1
libraries consisted of Sau3A partial digests of adult genomic DNA
from a highly inbred strain of genotype: y; cn bw sp. In order to
minimize ambiguities in the PCR assays resulting from duplicate
clones, the master library, of which copies are being
distributed, was derived from the original libraries by streaking
each of the 9216 clones for single colonies and then repicking
individual colonies. The restreaking and library replication was
carried out at LBL.
RETRIEVAL OF P1 CLONES FROM THE LIBRARY.
A common question about the library is about nomenclature. There
are 96 microtiter plates in the library. In each microtiter plate
there are 96 wells and they are labeled in an alphanumerical
fashion. However, in our clone lists we describe the positions
using two numbers. The first number in our clone identification
refers to the microtiter plate. The second number is a conversion
number for the alphanumerical position in the plates. The
conversion system that we use can be most easily described as
reading a book. Counting begins with the well in the upper left
hand of the plate. Thus, position A1 becomes 1. The numbers
increase as you move from left to right in the first row. A2
becomes 2, A3 is 3 etc. until you reach A12, which is 12. In the
second row we begin counting at the left hand well at 13, thus B1
is 13. This continues across the row until B 12 is 24. This
system continues down the plate with C1 as 25, etc. Ultimately,
the bottom well on the right hand side H12 is 96. Using this
system, a clone labeled 12-23 would be on the 12th plate in well
B11.
Another common question concerns how to isolate the clones. All
the plates have been covered with a plastic plate sealer. This
plate sealer should stay on the plates at all times and the
plates themselves should never be thawed. If you want to isolate
a clone, it is possible to pierce the plate sealer over an
individual well with a sterile needle, or a sterile eppendorf
tip. The clones can then be streaked on LB kanamycin (50
micrograms/ml of kanamycin) and grown overnight.
The library was constructed in two different vectors. In each
plate the clones in the wells 1 through 40 (A1 through D4)
contain inserts in the P1 vector NS582 tet14ad10. In each plate
the wells 41-96 (D5 through H12) contain inserts in the P1 vector
ad10sacBII.
References:
a. General reference for the P1 cloning system:
N. Sternberg, 1990 Bacteriophage P1 cloning system for the
isolation, amplification, and recovery of DNA fragments as large
as 100 kilobase pairs. Proc. Natl. Acad. Sci. USA 87: 103-107.
b. Construction of the Drosophila NS582 tet14 ad10 library and
associated methods:
D. A. Smoller, D. Petrov and D. L. Hartl, 1991 Characterization
of bacteriophage P1 library containing inserts of Drosophila DNA
of 75-100 kilobase pairs. Chromosoma 100: 487-494.
c. Description and use of the ad10 sacBII vector:
J. C. Pierce, B. Sauer, and N. Sternberg, 1992 A positive
selection vector for cloning high molecular weight DNA by the
bacteriophage P1 system: Improved cloning efficacy. Proc. Natl.
Acad. Sci. USA 89: 2056-2060.
Lozovskaya, E. R., D. A. Petrov and D. L. Hartl, 1993 A combined
molecular and cytogenetic approach to genome evolution in
Drosophila using large-fragment DNA cloning. Chromosoma
102:253-266.
d. Amplification of clone ends in ad10 sacBII by PCR:
Nurminsky, D. I. and D. L. Hartl, 1993 Rapid and efficient
amplification of the ends of DNA fragments cloned in
bacteriophage P1. Biotechniques (in press).
It is also worth noting that direct sequencing of the ends works
in about 80% of the cases. Within the Center, we have been using
standard cycle sequencing protocols for the ABI (dye terminator)
or Pharmacia (labeled primer) automated fluorescent sequencers.
For the ad10 sacBII vector we have been using the following
primers:
SP6L (23 bases) 5' GGCCGTCGACATTTAGGTGACAC 3';
T7L (24 bases) 5' CCGCTAATACGACTCACTATAGGG 3'.
A template preparation protocol for direct radioactive sequencing
of P1 ends is available from David Smoller, Genome Systems, Inc.,
7166 Manchester Road, St. Louis, Missouri, 63143. It is also
worth mentioning that David Smoller's company, for a reasonable
price, is able to screen the same Drosophila library, as well as
an additional 4000 clones with any single copy Drosophila probe.
IN SITU LOCALIZATIONS OF P1 CLONES.
A list of P1 clones localized to the euchromatin of Drosophila
melanogaster by in situ hybridization with the salivary gland
chromosomes (Oregon R) is provided. The extent of the
hybridization signal is indicated by the `starting band' and
`ending band' table entries. The cytology was carried out by
Elena R. Lozovskaya and Robert W. Jones of the Hartl laboratory.
The experimental procedures and cytological localizations have
been carried out as carefully as possible, and we are confident
that a very high percentage of the assignments are correct.
However, in a project of this magnitude, there is an inevitable
chance of error being introduced at any of a number of stages.
There are also differences in judgment, for example, in deciding
whether a clone with multiple sites of hybridization has one or
more major sites of hybridization. In addition, there is the
possibility that some mix-ups occurred in the restreaking and
repicking of the library; many of the in situ hybridizations were
done on the original library, prior to resteaking. There are
enough cross-checks in the experimental design of the Drosophila
Genome Project that any misplaced clones will be identified and
corrected eventually, but users should always check for
themselves. Therefore, prior to using any clone, it would be
advisable to verify the cytological location by in situ
hybridization. If there is any discrepancy with the assignment,
please inform us immediately so that we investigate. Contact by
email HARTL@MCZ.HARVARD.EDU or FAX 617-496-5854. In the event
that a P1 clone you need does not match the description in the
library as distributed, the Hartl laboratory can try to recover
it from the original plates. In any event, we would appreciate
any additional information about these clones that users could
provide.
A PROTOCOL FOR MAKING P1 DNA:
1. Grow an overnight culture in 25 micrograms/ml kanamycin. 2.
Inoculate 500 ml of LB (25 micrograms/ml kanamycin) with 0.5 ml
of the overnight culture. Shake at 325 rpm at 37 degrees C for
about 3 hours (OD550 = 0.15).
3. Add 5 ml of 0.1 M IPTG (dissolve 0.6 g in 25 ml of ddH2O and
filter sterilize) to the 500 ml culture. Shake for another 3
hours at 37 degrees C until OD550 = 1.3 to 1.5.
4. Harvest the cells (5K in GSA rotor for 10 minutes), and
proceed with the Qiagen maxi-prep according to the kit protocol.
5. Resuspend the DNA (10-30 micrograms) in a suitable volume of
TE.
DATA BASED ON CONTIG ASSEMBLY.
Contigs of overlapping P1 clones are being assembled by STS
content mapping. The principle of physical map construction based
on STS content mapping is straightforward, as shown by the
following example. Consider three P1-clones denoted A, B, and C
that are close together in the genome, and suppose that their
content of 7 STS markers is as follows: A contains STS markers 1,
2, and 3; B contains markers 4, 6, and 7; and C contains markers
2, 4, and 5. Then it is clear that the clones must overlap, and
the unique ordering consistent with the data is A-C-B (or the
reverse). The STS sites are ordered within the clones as (1 3) 2
5 4 (6 7), where the parentheses around any markers indicate
incomplete specification of the order. In addition, the STS
content strategy requires that these single copy markers be both
mapped and at least partially sequenced. In this way, in addition
to identifying the overlaps between large cloned inserts, STS
content mapping provides a mechanism for the introduction of
biological content, flexibility and community access into the map
as it is being constructed.
STSs derived from the ends of mapped P1 clones and P element
insertion sites are being positioned by the mapping group at LBL.
STSs derived from the sequences of Drosophila genes that have
been deposited in GenBank are being mapped in the Hartl
laboratory. The P1 data table presents information on STSs that
have been derived from the ends of the insert DNA in the P1
vector. These sequences have been generated using the SP6 primer
site (S_STS) and T7 primer site (T_STS) that flank the Drosophila
insert in the ad10 sacBII vector. The table also presents data on
which STSs from other P1s, P element insertion sites, or known
genes have been mapped to a particular P1 (Hit_by_STS). By
searching for all entries with a given STS you can obtain the
data necessary to assemble contigs. We hope to be able to
represent these graphically in a later version of the database.
The work at LBL is being jointly managed by Bill Kimmerly, Chris
Martin, and Michael Palazzolo. Bill Kimmerly is the day to day
supervisor of the research associates on the project.The research
associates working on the mapping project at LBL are: Karen
Stultz; Victor Stevko; Ami Richardson; Gail Shirley; and Dan
Hong. Charles Yu is an undergraduate also working on the project.
LETHAL P ELEMENT INSERTIONS
The overall goal of this part of the project is the analysis of P
element insertion sites that disrupt vital autosomal genes in
order to cross-reference the physical, cytogenetic and genetic
maps of the Drosophila melanogaster genome. By defining STS's
within sequences adjacent to all those insertions disrupting
different vital genes, this collection would serve as a versatile
link between the genetic and physical maps of the Drosophila
genome. There are thought to be about 4,000 autosomal Drosophila
genes capable of mutating to lethality. Our original project
involved a collection of 1,800 autosomal recessive lethal P
insertion lines, that were expected to define approximately 1,100
vital genes on the physical map, or about 27% of the total.
Our goal is to create a collection of 1,000-1,200 Drosophila
strains meeting specific quality criteria. Lines should contain
single P element insertions each defining a unique vital gene. A
group of 1,800 candidate strains has been assembled; non-
redundant, single- insert strains causing recessive lethality
will be selected and mapped from among these lines through seven
sequential steps:
1. Map the chromosome location of the insertion in each of the
1,800 lines by in situ hybridization to polytene chromosomes.
2. Identify and eliminate lines containing background lethal
mutations from the initial collection of 1800 lethal single P
insertion strains.
3. Identify and remove lines with two insertions, and also
redundant lines, in which the same gene is mutated, from the
collection of 1800 lethal single P insertion strains.
4. Identify and eliminate lines in which the P insertion has not
caused a lethal mutation.
5. Plasmid rescue DNA flanking the P element insertion from each
of the approximately 1,100 lines that are expected to remain
after the criteria of specific aims 2-4 have been applied.
6. Determine the sequence of approximately 400 bp of genomic DNA
immediately adjacent to the site of insertion in each of these
lines to provide an STS for mapping onto the P1 library.
We have collected pre-existing lethal lines from several
laboratories as the starting material for this project. These
initially included the Spradling, Rubin, Scott and Jan
laboratories. More recently we have initiated a collaboration
with Istvan Kiss which will allow us to substantially increase
the number of P-induced lethals available for the project. We
would appreciate hearing from individuals with collections of P-
induced lethal, sterile, or visible mutations that they would
like to make available. Contact Allan Spradling
(email:spradling@mail1.ciwemb.edu or FAX 410-243-6311).
The in situ hybridization localization of P element insertion
sites (Step 1) is being carried out in the Rubin laboratory by
Todd Laverty, Glenn Doughty, Wan Yu and Donna Nakahara. The
Genetic verification tests (Steps 2 and 3) are being carried out
in the Spradling laboratory by Allan Spradling and Dianne Stern.
The first collection analyzed was that from the Spradling
laboratory. Lines will be deposited in the Bloomington Stock
Center when steps 1-3 above have been completed and will be
posted here at that time. We expect the first 500 lines to be
available from the Stock Center sometime this summer.
References:
The isolation of the P element lines from the Spradling
laboratory was described in: Karpen, G.H. and Spradling A.C.
(1992). Analysis of subtelomeric heterochromatin in the
Drosophila minichromosome DP1187 by single-P-element insertional
mutagenesis. Genetics 132: 737-753.
The PZ-enhancer trap element used to generate the Spradling lab
lines is described in Mlodzik, M. and Hiromi, Y. (1991). The
enhancer trap method in Drosophila: its application to
neurobiology. In: Gene Expression in neural tissues. Methods in
Neuroscience, Vol 9. P.M. C. Orlando, ed. Academic press.
*** DIN 11
GENETIC NOTES
CORRECTIONS FOR THE REDBOOK
Dan Lindsley and Georgianna Zimm, Dept. of Biology, U. of
California, La Jolla, CA 92093. 619-534-3109, FAX/0053,
REDBOOK@JEEVES.UCSD.EDU, ZIMM@JEEVES.UCSD.EDU
(p=page; L=left; R=right)
p 215L, fj (cytology): "Df(2R)11B" to "Df(2R)Pcl11B"
p 215L, fj (cytology): "Df(2R)Pcl-w5" to "Df(2R)Pcl-W5"
p 548L, "Phb: Photophobe" to "Ppb: Photophobe"
p 548L, change all table and text entries from "Phb" to "Ppb"
p 549L, "Photophobe: see Phb" to "Photophobe: see Ppb"
p 702L: remove the references for the gene tbs
p 782L, wt (alleles): Insert this reference (after left
parenthesis) "Mglinetz and Vikulova, 1977, Genetika 13:
1318-20;"
p 782R, wt (cytology): Second line should be "Df(2R)Pcl-W5 =
Df(2R)55A-B;55C but not Df(2R)Pcl11b"
p 854L, Df(2R)Pcl (table): "Df(2R)Pcl11B[beta]" to
"Df(2R)Pcl[beta gamma]"
p 854L, Df(2R)Pcl (table): "Df(2R)Pcl-W5" to
"Df(2R)Pcl-W5[delta]"
Note: Page corrections made in Photophobe corrections of
Ballinger.
Editor's note: A complete list of reported corrections to the
Redbook and to Ashburner's Greybook are maintained on FlyBase.
See flybase/greybook/errors.txt and flybase/redbook/update.txt. A
more coherent version of the latter will be available soon as
redbook/errors.txt. -- K.M.
*** DIN 11
DROSOPHILA INFORMATION NEWSLETTER
Volume 12, October 1993
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing submissions.
To maintain the original format when printing DIN, use Courier
10cpi font on a standard 8.5" x 11" page with 1" margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 12
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the E-
mail header and add you to the list. Use your Internet address if
you have one. You will receive confirmation by E-mail if you have
successfully signed on to the list. If you are on the list and do
not wish to receive DIN, or you want to remove a soon-to-be-
defunct address, replace SUB in the above message with UNS. The
SUB command can also be used to correct spelling errors in your
real name; the new entry will simply replace the old as long as
it was sent from the same USERID@NODE address.
*** DIN 12
DIN Vol. 12 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Sandler Lecture - Call for nominations
>Faculty position available
>Research assistant position available
>Bloomington Stock Center news
>REQUESTS FOR MATERIALS
>Ovarian cDNA library and mutants
>Mutations at 68EF
>MATERIALS AVAILABLE
>Genetics and Biology of Drosophila vols 3a,b,d,e
>TECHNICAL NOTES
>Needle sharpening for embryo injections
*** DIN 12
ANNOUNCEMENTS
CALL FOR NOMINATIONS - LARRY SANDLER MEMORIAL LECTURE
We invite the nomination of candidates to present the
seventh Larry Sandler Memorial Lecture at the 1994 Drosophila
Conference. The Sandler Lecture is given on the first night of
the conference; the 1994 conference will be held at the Sheraton-
Chicago Hotel from April 20-24. Any student completing a Ph.D. in
an area of Drosophila research in calendar year 1993 is eligible
and may be nominated by his/her thesis advisor. Past recipients
of this honor are: Dr. Bruce Edgar (1988), Dr. Kate Harding
(1989), Dr. Michael Dickinson (1990), Dr. Maurice Kernan (1991),
Dr. Doug Kellogg (1992), Dr. David Schneider (1993). The Sandler
Lecturer will be chosen by a committee composed of Andrew Clark,
Ian Duncan, Ruth Lehmann, Don Ready, Barbara Wakimoto and Mariana
Wolfner. Nominations should include a curriculum vita, a thesis
abstract of one or two pages, and a letter of nomination from the
advisor. Nominations should be sent by December 14, 1993 to:
Mariana Wolfner, Section of Genetics and Development, Cornell
University, 423 Biotechnology Bldg., Ithaca NY 14853-2703.
Telephone: (607) 254-4801, FAX: (607) 255-2428.
*** DIN 12
CORNELL UNIVERSITY - SECTION OF GENETICS AND DEVELOPMENT
Our Section is seeking an ASSISTANT PROFESSOR for a tenure
track position, available in the Fall of 1994. The successful
candidate will be expected to establish a vigorous externally
funded research program in an important area of modern Genetics.
The primary teaching responsibility will be to design and offer a
lecture course in genetic analysis, with emphasis on eukaryotes,
for advanced undergraduate and beginning graduate students. We
strongly encourage applications from women and members of
underrepresented minority groups. Applications should include a
curriculum vitae, reprints of recent publications and a brief
statement of present and future research interests. Complete
applications and three letters of recommendation, solicited by
the applicant, should be mailed to: G & D Search Committee, 101
Biotechnology Building, Cornell University, Ithaca, NY
14853-2703. Applications will be reviewed beginning November 15,
1993. Cornell University is an Affirmative Action/Equal
Opportunity Employer.
*** DIN 12
RESEARCH ASSISTANT POSITION AVAILABLE
Will assist in genetic analysis of Drosophila mutants
displaying behavioral, developmental, and neurological
phenotypes. Duties will include: maintaining and selecting
Drosophila mutant stocks; performing genetic crosses; isolating
new mutants and establishing stocks. Long term employment
position; candidates with lab experience in genetics will be
given preference. Please send cv to S. Benzer, Division of
Biology 156-29, Caltech, Pasadena, CA 91125.
*** DIN 12
BLOOMINGTON STOCK CENTER NEWS
* The Bloomington Stock Center will be closed December 20 -
31, 1993. Large orders received after noon EST on the 9th of
December will not be shipped until the new year due to the high
rate of loss we experience during the Christmas mail crunch.
Smaller orders (our call) received by noon EST on the 16th will
be shipped on the 20th, but we recommend that you avoid ordering
stocks during this period.
* A new set of ry[+]-marked P insertions from the Drosophila
Genome Center are now available from the Bloomington Stock
Center. Most of these stocks carry lethal inserts on 3; the rest
are male sterile inserts on 2 or 3. All carry the PZ construct. A
list of insertion sites has been posted on bionet.drosophila and
the relevant stock lists on FlyBase (p-list.txt, p-list.rpt, p-
by-location.txt and p-by-location.rpt2) have been updated to
include these stocks.
* Our P stock stockkeeper, Starr Eck, is recovering from
surgery and is expected to be away for another 3 to 5 weeks.
Requests for more than 50 P stocks at a time will not be filled
until Starr returns to work. If you are interested in receiving
the whole Genome Center set as soon as possible ask to be added
to the waiting list.
* The set of unlocalized mini-w[+]-marked P inserts from Dan
Lindsley will soon be discarded. If you want any of these stocks
order them now.
* There is mounting evidence that stocks carrying both hsFLP
and FRTs are unstable. We will soon discard the hsFLP + FRT
stocks from the Xu and Rubin set (Development 117:1223). If you
aren't among the 5,007 people that have already received these
stocks and would like to receive them despite the potential for
problems, order them now. FRT-only and hsFLP-only stocks will
continue to be maintained at the center.
*** DIN 12
REQUESTS FOR MATERIALS
OVARIAN cDNA LIBRARIES
Kathleen A. Fitzpatrick, IMBB, Simon Fraser U., Burnaby, B.C.,
Canada V5A 1S6. (604) 291-5931, KATHLEEF@SFU.CA
We need a good ovarian cDNA library as well as alleles of
known tyrosine kinase loci, such as sevenless, hopscotch,
breathless, and any others for which there is a scorable
phenotype. We have some genes that interact with torpedo and want
to determine whether they will interact with other tyrosine
kinase genes or only with top. Thanks for any help you can give
us.
*** DIN 12
MUTATIONS AT 68EF
Helen Benes, Dept. of Biochemistry/Molecular Biology, Slot 516,
U. of Arkansas for Medical Sciences, 4301 W. Markham St., Little
Rock, AR 72205. FAX 501-686-5782, HXBENES@LIFE.UAMS.EDU
We would appreciate any information on D. melanogaster
stocks with enhancer trap insertions or lethals that map to, or
reasonably near to, the 68E/F region. The lethals could be
isolates of screens following mutagenesis by EMS, DEB, X-ray, P
elements, etc. Thank you.
*** DIN 12
MATERIALS AVAILABLE
GENETICS AND BIOLOGY OF DROSOPHILA vols 3a,b,d,e
J.S. Heilig, MCD Biology, U. of Colorado, Boulder, CO 80309-0347.
HEILIG@HORTON.COLORADO.EDU
I have one copy each of volume 3a,b,d,e of Genetics and
Biology of Drosophila and am happy to sell them (at cost) to
someone whose interest in, and use for, them exceeds mine. They
all are new copies, I have them from an attempt to get available
volumes of the series from distributors in the U.K. since only
photocopies are available in the U.S. The only other volumes
available are 2 a and d. Volume 3a cost me $167.65, vols. b,d
and e cost $155.70 each. If you are interested in these books
please contact me soon. I will return them to London by the end
of October.
*** DIN 12
TECHNICAL NOTES
NEEDLE SHARPENING FOR EMBRYO INJECTIONS
James A. Powers, HHMI, Dept. of Biology, Indiana U., Bloomington,
IN 47405. 812-855-7674, FAX/2577, JPOWERS@BIO.INDIANA.EDU
For me, doing injections isn't so bad once I have a good
needle. However, breaking needles to get a usable tip was often
very frustrating. I have adapted a technique for sharpening
needles for mouse embryo injections (Gundersen et al. (1993)
Biotechniques, 14(3), 412-414) for use in Drosophila. The needles
are ground in a slurry of "sand" to give a beveled tip that is
sharp and has a large enough bore to resist clogging.
A) Preparation
1) Wash silicon carbide (Grit 120 from Buehler Ltd., Lake Bluff,
Illinois. They have a $50 minimum order so you get 5 lbs. which
should last a very long time.) in several changes of MQ water
until water remains clear with no fines floating on the surface.
2) Mix washed sand and MQ water (1:3).
3) Autoclave.
4) Store at 4C.
B) Method
1) Backfill needle
2) Place needle in microinjection holder.
3) Apply pressure with syringe to avoid backflow of the slurry
solution into your needle. I use a 60ml syringe placed in a
standard caulking gun.
4) Swirl slurry at medium to high speed by stirring with a stir
bar at about "7"(out of 10) on a stir plate.
5) Hold needle steady in slurry at an angle for about 1 min. 45
sec. Adjust the time to get the bore size you want.
6) Maintain pressure and rinse needle with MQ H2O from a squirt
bottle. Release pressure and blot excess water from needle (but
don't touch the tip).
7) Mount needle and inject.
C) Notes
1) This method will eventually chew up your stir bar.
2) I rinse and reautoclave the sand about once a week. I'm not
sure this is necessary, but it doesn't hurt.
3) After trying several containers, I have settled on a Pyrex
storage dish (#3250-DO) 100 x 80 mm. I use about a 1cm layer of
sand.
*** DIN 12
DROSOPHILA INFORMATION NEWSLETTER
Volume 13, January 1994
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 13
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 13
DIN Vol. 13 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Crete Developmental Biology Workshop
>1994 and 1995 US Drosophila Conferences
>Bloomington Stock Center news
>FlyBase and bionet.drosophila reminder
>REQUESTS FOR MATERIALS
>Wild-caught bb mutants
>MATERIALS AVAILABLE
>Monoclonal antibody against embryonic chordotonal organs
>TECHNICAL NOTES
>Preparation of DNA from single embryos for PCR
*** DIN 13
ANNOUNCEMENTS
CRETE DEVELOPMENTAL BIOLOGY MEETING
An EMBO International Workshop on the MOLECULAR AND
DEVELOPMENTAL BIOLOGY OF DROSOPHILA will be held at Kolymbari,
Crete (Greece), June 19 - 25, 1994. The workshop will be
co-sponsored by the U. of Crete and the Molecular Biology and
Biotechnology Inst. of the Research Center of Crete. As has been
the case in previous years, the objective of the workshop is to
discuss topics in gene organization and expression, early
development, pattern formation, developmental neurobiology and
evolution. Approximately 80 participants will be selected by
vote by the organizing committee from applicants. The
participants are expected to contribute to the subject coverage.
Applications should include a short summary of research interests
and a brief C.V. if such information is thought to be important
in facilitating the selection process. Please note that
acceptance to the meeting is strictly limited to the individuals
accepted.
The deadline for applications is January 10, 1994. For
logistical purposes we need to adhere strictly to this deadline.
Applications should be sent to:
CRETE WORKSHOP
c/o Dr. S. Artavanis-Tsakonas
Yale University School of Medicine - BCMM #236
295 Congress Avenue - P.O. Box 9812
New Haven, Connecticut 06536-0812 - U.S.A.
A registration fee of $400.00 will be remitted upon
acceptance. Local expenses in Crete will be covered.
Participants are expected to finance their travel to Crete.
However, a small number of grants in aid for partial travel
support may become available. Preference will be given to junior
investigators.
The Organizing Committee: M. Ashburner (Cambridge U.), S.
Artavanis-Tsakonas (Yale U.), B. Baker (Stanford U.), A.
Bucheton, (CNRS), L. Cooley, (Yale U.), V. Corces (Johns Hopkins
U.), M. Gatti (U. of Rome), W. Gehring (Basel U.), W. Gelbart
(Harvard U.), D. Glover (Dundee U.), C. Goodman (USC - Berkeley),
D. Hogness (Stanford U.), D. Ish-Horowicz (ICRF-U. of Oxford), H.
Jackle (Max Planck - Gottingen), F. Kafatos (EMBL), D. Kankel
(Yale U.), K. Louis (U. of Crete), P. Lawrence (MRC - Cambridge),
J. Modolell, (U. Autonoma de Madrid), G. Morata (U. Autonoma de
Madrid), G. Rubin (USC - Berkeley), R. Saint (U. of Adelaide), G.
Schubiger (U. of Washington), B. Shilo (Weizmann Inst.), P.
Simpson (Strasbourg), A. Spradling (Carnegie Inst. of
Washington).
*** DIN 13
35th ANNUAL DROSOPHILA RESEARCH CONFERENCE
The next US Drosophila Conference will be held in Chicago,
Illinois, at the Sheraton Chicago Hotel, 301 East North Water
St., April 20-24, 1994. The deadline for advance registration is
February 14, 1994. Advance registration is $110 for GSA members
($55 for graduate students), and $140 for non-members ($75 for
graduate students). The deadline for receipt of abstracts has
passed. The Program Chairman is Victoria Finnerty, Biology
Dept., Emory U., 1510 Clifton Rd., Atlanta, GA 30322, USA (e-
mail: VICTORIA@BIOLOGY.EMORY.EDU). Contact The Genetics Society
of America, 9650 Rockville Pike, Bethesda, MD 20814-3998 (301-
571-1825) for registration and housing forms.
The 1995 US conference will be held April 5-9 in Atlanta,
Georgia.
*** DIN 13
BLOOMINGTON STOCK CENTER NEWS
* USE STATISTICS FOR 1993 -- 16,785 stocks were shipped from
the Bloomington Stock Center in 1993. This represents a 36%
increase compared to 1992, and a 401% increase over the past 5
years. Weekly averages for the last quarter of 1993 were 58
requests for stocks or information, 48 shipments, and 442 stocks
shipped. 35% of those shipments went outside the USA: 23% to
European Community countries, 3.6% to Canada, 3.6% to Japan, 2.4%
to Israel, and 2.9% to an assortment of other countries.
Deficiency stocks continue to be the most requested category.
* USER SURVEY FOR NIH -- At present NSF is the only funding
agency providing support for Drosophila stock centers. NIH has
expressed an interest in sharing support for the Bloomington
center with NSF if we can demonstrate that a large proportion of
our users are funded by NIH. We will be distributing user
surveys over the next few weeks to gather information about our
users' sources of research support. We apologize for one more
piece of paperwork/e-mail (but imagine how we feel!), and will
very much appreciate your prompt response.
* SEND US YOUR REFERENCES -- In response to Vice-President
Gore's good-government activities, NSF is asking stock centers
funded by its program to provide documentation of specific
scientific advances that were supported by materials from the
center. We have started maintaining a database of publications
that made significant use of stocks received from the Bloomington
Stock Center. It would be extremely helpful if you would send us
references for your relevant papers (now and in the future) with
a VERY brief description of the role of center stocks, for
example, 'used P insert at 25F to clone gene x'. Send e-mail to
MATTHEWK@INDIANA.EDU.
* HELP US COPE -- As you can see from the statistics cited
above, use of the center has increased dramatically over the past
five years. It is increasingly important that all of our users
use the center responsibly. Please help us maintain our current
level of service by complying with the following requests:
1. We are funded as a research resource, not as a teaching
resource. Please do not order stocks from us for teaching
purposes unless those genotypes are not available elsewhere, and
PLEASE!!! do not refer teachers, parents, and science fair
advisors to us for help with their student projects.
2. If the same stocks are available from both Bloomington
and the Umea Stock Center, workers in European labs should order
stocks from Umea. It is quite time-consuming for us to routinely
check European requests against the Umea stock list and we will
soon stop doing this altogether. Requests from European labs for
non-P stocks must note that the requested stocks are not
available from Umea or the order will be returned by post
unfilled.
3. Use e-mail if you have it (to MATTHEWK@INDIANA.EDU).
Sending a FAX is very time-consuming compared to responding to an
e-mail message and FAXes usually have to be trimmed or folded to
fit into our file folders.
4. When you place your first order from a new address
explicitly state that the address provided is a new one. Mailing
labels are automatically filled in from our 'address' database
(1,760 names and addresses) and your stocks may go to your old
address if you count on us to notice that you have moved. We
often catch these, but it creates extra work to correct them
after your request has been entered into the database. Also, it
is helpful if you always use the same form of your name when
ordering. It would be very helpful if some of you Johnsons and
Martins would change your last names (just kidding on that one).
5. Order efficiently. Whenever possible, order by stock
number; check your request for typos in the stock numbers before
sending it. If you do not have access to our stock list, include
the gene symbol in your request (e.g., fzy instead of or in
addition to fizzy). Learn to use FlyBase so you always have
access to current stock lists (read stocks.doc before trying to
search the stock lists). Don't order Bowling Green stocks from
Bloomington, and vice versa. Don't order the same stocks from
multiple stock centers 'just to be sure'. If you find yourself
often ordering one or two stocks a week for several weeks in a
row, consider delaying your next order for a week or two so you
can order everything you will need for a while at once. For
small orders, the processing and packaging time vastly outweighs
the stock set up time, and up to 12 stocks can be shipped for the
same postage as one. It is very helpful when workers in the same
lab pool their orders. We try to identify multiple orders from
the same lab and ship them together, but this takes extra time,
and we aren't always aware of you lab affiliation.
6. Check the redbook or FlyBase for basic information about
a gene or an aberration before calling the stock center for such
information.
* NO, IT WASN'T YOUR IMAGINATION -- Try to forgive us if
you suffered from Kathy's even-crankier-than-usual disposition
this fall. We were seriously oversubscribed and biting a head
off now and again just felt too good to resist. Our five year
renewal application is in, we are once again fully staffed, and
spring isn't all that far off, so you should be safe for a while.
*** DIN 13
FLYBASE
A new release of FlyBase will appear on the server sometime
in January. It will be announced on bionet.drosophila. If you
don't have local access to the bionet.drosophila discussion group
you can subscribe directly by sending an e-mail message to
BIOSCI@NET.BIO.NET asking to subscribe to bionet.drosophila. A
person will read your message, so it need not be in any specific
format. You may post a message to the group by sending your
message to DROS@NET.BIO.NET.
*** DIN 13
REQUESTS FOR MATERIALS
WILD-CAUGHT bb MUTANTS
Leonard G. Robbins, Genetics Program, S308 Plant Biology,
Michigan State U., E. Lansing, MI 48824-1312. 517-355-0337,
FAX/353-1926, 21675MGR@MSU.EDU or 21675MGR@MSU.BITNET.
For an attempt to find other instances of Rex, I would
appreciate cultures of any wild-caught or spontaneous
melanogaster bb mutants.
*** DIN 13
MATERIALS AVAILABLE
MONOCLONAL ANTIBODY AGAINST EMBRYONIC CHORDOTONAL ORGANS
Beate Lichte, Thilo Schneider, and K.-F. Fischbach, Inst. fuer
Biologie III, Schaenzlestr. 1, D-79194 Freiburg, Germany.
0761-203-2730, FAX/2745, LICHTE@SUN1.RUF.UNI-FREIBURG.DE or
KFF@SUN1.RUF.UNI-FREIBURG.DE.
We recently produced (as a "by-product" of our current
research) a mouse monoclonal antibody which recognizes
exclusively all chordotonal organs of the Drosophila embryo in
histochemical staining experiments. The staining is very strong
without any background. So, if anyone is interested in using
this antibody, e.g. as a marker, please contact us.
*** DIN 13
TECHNICAL NOTES
PREPARATION OF DNA FROM SINGLE EMBRYOS FOR PCR
Maryann Garozzo and Alan C. Christensen, Dept. of Biochemistry
and Molecular Biology, Thomas Jefferson U., 233 S. 10th Street,
Philadelphia, PA 19107, 215-955-5190, FAX/5393,
CHRISTEN@CALVIN.JCI.TJU.EDU.
We have adapted the single fly PCR method of Gloor and
Engels (DIS 71: 148-149, 1992, and DIN Vol. 1, 1991) to single
embryos. We have also slightly modified their procedure for
single fly PCR which gives less background in our hands. The
ability to use single embryos for PCR allows one to determine the
genotype of an embryo following phenotypic analysis or other
manipulation. Since there are relatively few good visible
phenotypic markers for embryos, polymorphic sequence tagged sites
can be used as chromosome markers in individual embryos. Single
P element inserts can also be used; in this context they serve as
portable sequence tagged sites. The sex of the embryo could also
be determined by this method.
1. DNA PREPARATION FROM EMBRYOS. Single embryos are squashed
in 10 ul of Gloor and Engels' extraction buffer (10mM Tris pH
8.2, 1mM EDTA, 25mM NaCl, 200ug/ml proteinase K freshly diluted
from a frozen 20mg/ml stock). This is most conveniently done in
a 0.5 ml microfuge tube, using the pipettor tip to crush the
embryo in the buffer. Care should be taken to avoid getting the
embryo stuck inside the pipettor tip. The homogenate is
incubated at 37[o]C for 30 minutes, then 95[o]C for 2 minutes,
then stored at 4[o]C. It is easy to program a thermocycler for
these incubations. We typically use 1 ul of this extract in a
15-50 ul PCR using standard conditions, as appropriate to the
primers.
2. NOTES ON THE EMBRYOS. We have successfully amplified single
copy sequences with this procedure using embryos 12 hours old and
older. It also works with first instar larvae. The embryos may
be dechorionated or not. If they are dechorionated, we have
found (not surprisingly) that the bleach must be thoroughly
rinsed off. We have also used this procedure on embryos that
have been permeabilized with heptane, immersed in halocarbon oil
or stained for programmed cell death with acridine orange (Abrams
et al., Development, 117: 29-43, 1993) If the embryos have been
in halocarbon oil, we wash the oil off with heptane, although
this may not be necessary. None of these procedures appears to
interfere with DNA extraction or PCR. We have not attempted the
procedure with fixed embryos.
3. MODIFICATIONS OF THE SINGLE FLY PCR PROCEDURE. Generally,
the procedure of Gloor and Engels works very well. However, we
have occasionally had problems with spurious background bands,
and these are often worse when the priming sites are absent in
the fly being tested. This problem is alleviated with no loss of
the bona fide amplification product by using less fly extract in
the PCR. For example, if the fly was homogenized in 50 ul, we
use 1 ul in a 50 ul reaction, rather than 1 in 15. Reducing the
number of PCR cycles from 30 to 25 also reduces the amount of
background with no loss of signal.
*** DIN 13
DROSOPHILA INFORMATION NEWSLETTER
Volume 14, April 1994
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 14
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 14
DIN Vol. 14 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>1994 and 1995 US Drosophila Conferences
>New book on development available
>NIAAA Program Announcement
>Bloomington Stock Center news
>REQUESTS FOR MATERIALS
>Anything in 62F
>MATERIALS AVAILABLE
>Compilation of Drosophila cDNA and Genomic Libraries
>TECHNICAL NOTES
>Injecting un-dechorionated eggs under ethanol
*** DIN 14
ANNOUNCEMENTS
35th ANNUAL DROSOPHILA RESEARCH CONFERENCE
The next US Drosophila Conference will be held in Chicago,
Illinois, at the Sheraton Chicago Hotel, 301 East North Water
St., April 20-24, 1994. Contact The Genetics Society of America,
9650 Rockville Pike, Bethesda, MD 20814-3998 (301-571-1825) for
registration and housing information.
The 1995 US conference will be held April 5-9 in Atlanta,
Georgia.
*** DIN 14
THE DEVELOPMENT OF DROSOPHILA MELANOGASTER
Edited by Michael Bate (University of Cambridge) and Alfonso
Martinez Arias (University of Cambridge)
A monograph in two volumes, this reference work represents the
most comprehensive synthesis of Drosophila developmental biology
currently available. The text is complemented with a full-color
Atlas for bench use, which graphically illustrates the day-by-day
development of the Drosophila embryo.
Contents:
Developmental Genetics of Oogenesis (A. Spradling)
Spermatogenesis (M. Fuller)
Mitosis and Morphogenesis in the Drosophila Embryo (V. Foe, G.
Odell, B. Edgar)
Maternal Control of Anterior Development in the Drosophila Embryo
(W. Driever)
Pole Plasm and the Posterior Group Genes (D. St. Johnson)
The Terminal System of Axis Determination in the Drosophila
Embryo (F. Sprenger, C. Nusslein-Volhard)
Maternal Control of Dorsal-Ventral Polarity and Pattern in the
Embryo (R. Chasan, K. Anderson)
Gastrulation in Drosophila: Cellular Mechanisms of Morphogenetic
Movements (M. Costa, D. Sweeton, E. Wieschaus)
Blastoderm Segmentation (M. Pankratz, H. Jackle)
Development and Patterning of the Larval Epidermis of Drosophila
(A. Martinez Arias)
Development of the Drosophila Tracheal System (G. Manning, M.
Krasnow)
The Terminal Regions of the Body Pattern (G. Jurgens, V.
Hartenstein)
Imaginal Disc Development (S. Cohen)
The Metamorphic Development of the Adult Epidermis (D. Fristrom,
J. Fristrom)
Hormones and Drosophila Development (L. Riddiford)
The Alimentary Canal (H. Skaer)
The Mesoderm and Its Derivatives (M. Bate)
Early Neurogenesis in Drosophila melanogaster (J. Campos-Ortega)
Embryonic Development of the Drosophila Central Nervous System
(C. Goodman, C. Doe)
The Peripheral Nervous System (Y.N. Jan, L.Y. Jan)
Formation of the Adult Nervous System (J. Truman, B. Taylor, T.
Awad)
Pattern Formation in the Drosophila Retina (T. Wolff, D. Ready)
Genetic Dissection of Eye Development in Drosophila (B. Dickson,
E. Hafen)
The Development of the Optic Lobe (I. Meinertzhagen, T. Hanson)
Epilogue (M. Ashburner)
Atlas of Drosophila Development (V. Hartenstein)
Poster: Drosophila Third Instar Eye Disc (T. Wolff)
1993, 1564 pp., illus. (147 in color), indexes, ISBN 0-87969-423-
8, 2-volume set, cloth; atlas, paper; poster -- $350. Can be
ordered directly by e-mail: benirsch@cshl.org, by phone: 1-800-
843-4388 (continental US and Canada), 516-349-1930 (all other
locations), by fax: 516-349-1946, or write to: Cold Spring Harbor
Laboratory Press, 10 Skyline Dr., Plainview, N.Y. 11803
Personal orders must be prepaid by personal check, credit card,
or money order. All checks must be in US dollars and drawn on a
US bank. Please $20 for postage. New York residents, add
appropriate sales tax.
*** DIN 14
NIAAA PROGRAM ANNOUNCEMENT
The following is an excerpt from a National Institute on
Alcohol Abuse and Alcoholism Program Announcement of particular
relevance to Drosophilists. For the complete announcement see the
Program Announcement, Genetic Studies in Alcohol Research (PA
93-086). Copies of this and other Program Announcements can be
obtained from the National Clearinghouse on Alcohol and Drug
Information (NCADI), P.O. Box 2345, Rockville, MD 20852,
telephone: 1-800-729-6686.
Information on research grants can be obtained from:
Robert W. Karp, Ph.D., Director, Genetics Program, Division of
Basic Research, National Institute on Alcohol Abuse and
Alcoholism, 5600 Fishers Lane, Room 16C-05, Rockville, MD 20857.
E-mail: RKARP@WILLCO.NIAAA.NIH.GOV
ALCOHOL-RELATED GENETIC STUDIES IN INVERTEBRATES
Because of their small size, short generation time, and high
fecundity, the fruit fly Drosophila melanogaster and the soil
nematode Caenorhabditis elegans lend themselves to large-scale
systematic searches of tens to hundreds of thousands of
individuals to find single-gene mutations conferring a specific
phenotype of interest. For both of these invertebrate species
sophisticated genetic and molecular methods are available which
facilitate the cloning of genes based either on the phenotypes
they confer, or on their known map locations (Ashburner, 1989;
Herman and Shaw, 1987; Mello, et al., 1991; Coulson, et al.,
1991). The combined power of these methods has led to important
contributions to our understanding of development and functioning
of the nervous systems of these species. Many of their genes
critical for neurotransmission and central nervous system
development (e.g., those encoding neurotransmitter biosynthetic
enzymes and receptors, protein kinases, adenyl cyclases, G
proteins, ion channel subunits, cell adhesion proteins,
transcription factors) have homologues which function critically
in the vertebrate central nervous system as well (Molecular
Neurobiology of Drosophila: Cold Spring Harbor Laboratory meeting
abstracts, 1991; Chalfie and White, 1988). In both of these
species, single-gene mutants have been described which alter
sensitivity to volatile anaesthetics (Krishnan and Nash, 1990;
Sedensky and Morgan, 1991). Cloning of the mutated genes from
these mutants will serve to identify gene products which
participate in the physiology of anaesthetic sensitivity. The
cloned genes can also be used to isolate mammalian (including
human) homologues which will be invaluable for studying the
mechanisms of action of anaesthetics in these higher species.
This approach may well reveal targets for the action of
anaesthetics not yet disclosed by direct genetic or biochemical
studies on mammals. Although an approach based on systematic
mutant searches of mammals (e.g., mice) would certainly be
desirable, the impracticability of rearing a sufficiently large
number of individuals renders studies in invertebrates more
expedient. The example of volatile anaesthetics demonstrates how
an approach based on invertebrate genetic studies provides an
otherwise inaccessible entree to the elucidation of the mechanism
of action in vertebrates of a drug whose molecular targets have
not yet been definitively identified.
It would be of great interest to characterize in detail the
behavioral and developmental responses of Drosophila and
Caenorhabditis to ethanol. If such responses as attraction to,
consumption of, sensitivity to, tolerance to, and withdrawal from
ethanol, as well as ethanol-induced developmental defects can be
demonstrated, then systematic searches for single-gene mutations
affecting these responses can greatly facilitate the elucidation
of the entire chain of physiological events mediating these
responses. Cloning of the mutant invertebrate genes discovered
by these searches could then lead to cloning of homologous
mammalian genes with important functions in responses to ethanol.
It is difficult to predict in advance which (if any) invertebrate
ethanol-related behaviors will prove relevant to human
alcoholism. An objective test for true homology (based on shared
underlying genetic or physiological mechanisms), as opposed to
analogy (superficial behavioral similarity), is therefore
essential for guiding this line of research. Such a test can be
accomplished post hoc by testing human homologues of the
invertebrate genes for linkage to alcoholism in human pedigrees.
Areas needing further research include:
Characterization of behavioral and developmental responses of
Drosophila and Caenorhabditis to ethanol. Behavioral responses
can include attraction to, consumption of, sedation by, motor
impairment by, tolerance to, and withdrawal from ethanol.
Systematic searches (using either mutagens or wild populations)
for mutants altered in the responses mentioned above.
Mapping and cloning of the genes altered in mutants discovered in
these screens.
Characterization of the products of the cloned genes.
Cloning of mammalian (including human) homologues of the cloned
invertebrate genes.
Testing for linkage of the human homologues to alcoholism in
human pedigrees.
References
__________
Ashburner MA: Drosophila: A Laboratory Handbook. Cold Spring
Harbor, Cold Spring Harbor Laboratory Press, 1989
Coulson A, Kozono Y, Lutterbach B, Shownkeen R, Sulston J,
Waterston R: YACs and the C. elegans genome. Bioessays 13:413-
417, 1991
Herman RK, Shaw JE: The transposable genetic element Tc1 in the
nematode C. elegans. Trends Genet 3:222-225, 1987
Krishnan KS, Nash HA: A genetic study of the anesthetic response:
Mutants of Drosophila melanogaster altered in sensitivity to
halothane. Proc Nat Acad Sci USA 87:8632-8636, 1990
Mello CC, Kramer JM, Stinchcomb D, Ambros V: Efficient gene
transfer in C. elegans: extrachromosomal maintenance and
integration of transforming sequences. EMBO J 10:3959-3970, 1991
Molecular Neurobiology of Drosophila: Cold Spring Harbor
Laboratory meeting abstracts, Sept 25-29, 1991
Sedensky MM, Morgan PG: Genetics of response to volatile
anesthetics in Caenorhabditis elegans. Ann NY Acad Sci 625: 524-
531, 1991
Chalfie M, White J: The nervous system, in Wood WB (ed): The
Nematode Caenorhabditis elegans. Cold Spring Harbor, Cold Spring
Harbor Laboratory Press, 1988, pp 337-395
*** DIN 14
BLOOMINGTON STOCK CENTER NEWS
* NEW DEADLINE -- The weekly deadline for stock requests is
now 11 AM on Thursday. Large orders and requests that don't
include our stock numbers must be received on Wednesday to assure
inclusion in the current week's order.
* CLOSED FOR THE FLY MEETINGS -- The center will be closed
April 18 - 24. Orders received by 11AM on April 14 will be
shipped April 18. Orders received between 11AM April 14 and 11AM
April 28 will be shipped May 2. We are extremely busy for a few
weeks after the fly meeting. Please order only what you need
immediately during this period. See you in Chicago.
* WRONG BREAKPOINTS -- The breakpoints shown in our stock
list for Df(3R)p-XT103 #1962 were not correct. The reported
breakpoints for this deficiency are 85A2;85C1-2 (we had the
breakpoints for p-XT9 instead of p-XT103). Thanks to Hilary
Ellis for catching and reporting this error. There are without
doubt others. Typographical and transcription errors in the
stock lists will be identified and corrected when stocks are
added to the developing relational version of FlyBase. In the
meantime, always check the breakpoints in our stock list against
the new redbook or the aberrations file in FlyBase. We recommend
that you check the cytology yourself before investing significant
effort in any aberration stock.
* USER SURVEY FOR NIH -- Thanks to everyone who responded
to the user survey. At last count the response rate was 64%.
60% of respondents had research grants from NIH in 1993, another
8% had students or post-docs supported by NIH training grants,
and 4% of the survey population were NIH employees. Among the
200 NIH research grants held by respondents in 1993, 61% were
from NIGMS, 12% from NICHHD, 12% from NINDS, and 10% from NEI.
However, on average, groups with NEI grants were heavier users of
the center than groups with NIGMS grants - 34% of stocks shipped
to survey respondents went to groups with NEI funding, the same
proportion that went to NIGMS-funded groups.
* hsFLP+FRT COMBINATION STOCKS ARE UNSTABLE -- FRT sites
are damaged over time when maintained in stock with hsFLP, even
when stocks are kept at low temperature. It is very likely that
you will get poor clone production if you use FRTs that have been
kept with hsFLP for extended periods. We no longer maintain
these combination stocks. Everyone who received hsFLP+FRT stocks
from the center before we discarded them was notified of the
potential for problems. However, it appears that this
information has not always been relayed to all potential users in
each lab. If you continue to maintain these stocks in your lab
we strongly recommend that you discard them. Three stocks are
available from the center that can be used as a source of hsFLP:
#6 y w[1118] hsFLP1; Adv/CyO, #7 y w[1118] hsFLP1; Dr[Mio]/TM3,
and #279 w[1118]; MKRS, hsFLP3/TM6B. Make the necessary
hsFLP+FRT combination genotype only when you are ready to
generate clones.
*** DIN 14
REQUESTS FOR MATERIALS
Dr. Robert E. Nelson, UCLA, Molecular Biology Institute, Room
459, Los Angeles, CA 90024, Tel: 310-825-5267, e-mail:
nelson@ewald.mbi.ucla.edu.
Looking for stocks with transposable elements, mutations, and/or
deletions that map within or around 62F.
Thanks, in advance, Bob Nelson
*** DIN 14
MATERIALS AVAILABLE
Compilation of Drosophila cDNA and Genomic Libraries
Carl Thummel, Howard Hughes Medical Institute, 5200 Eccles
Institute of Human Genetics, Bldg. 533, Univ. of Utah, Salt Lake
City, UT 84112 U.S.A. 801-581-2937, FAX/5374,
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU.
The following is an update of the listing of Drosophila cDNA and
genomic libraries that are currently available and in common use.
Please do not request shipment of a library unless you have an
immediate use for it - many contributors are concerned about the
time and money involved in mailing their libraries. Also, please
inquire with local colleagues before requesting a library since
many of these libraries are already widely distributed.
cDNA LIBRARIES
--Nick Brown, Wellcome/CRC Institute, Tennis Court Rd, Cambridge
CB2 1QR United Kingdom Phone: 44-223-334128 FAX: 44-223-334089
Email: NB117@MB1.BIO.CAM.AC.UK
Vector/Insertion/Complexity/mRNA source
pNB40/see ref./3x10[5]/0-4 hr embryo
pNB40/see ref./3x10[6]/4-8 hr embryo
pNB40/see ref. 3x10[5]/8-12 hr embryo
pNB40/see ref./1x10[6]/12-24 hr embryo
pNB40/see ref./3x10[6]/imaginal discs
The Drosophila strain used is an isogenic second chromosome
stock: dp cn bw, from the Gelbart lab. Ron Blackman has made a
genomic library from this same strain (see below). The vector is
a pUC based plasmid with a SP6 promoter at the 5' end of the cDNA
and a T7 promoter at the 3' end of the cDNA. The cloning
strategy was directional and designed to maximize the number of
full-length cDNAs. A useful diagnostic of full-length cDNAs is a
non-coding G nucleotide at the 5' end, after the polyC tract; the
origin of this nucleotide is, however, unknown.
Reference: Brown, N.H., and F.C. Kafatos (1988) Functional cDNA
libraries from Drosophila embryos. J. Mol. Biol. 203: 425-437.
--Steve Russell, Dept. of Genetics, University of Cambridge,
Downing Street, Cambridge, CB2 3EH United Kingdom Phone:
44-223-337733 FAX: 44-223-333992 Email:
sr120@mbfs.bio.cam.ac.uk
All libraries were made with RNA isolated from Oregon R strain
Vector/Insertion/Complexity/mRNA source
NM1149/RI/2x10[6]/Male 3rd instar larvae
NM1149/RI/6x10[5]/Female 3rd instar larvae
NM1149/Directional: RI-HIII/3x10[6]/Adult male heads
NM1149/Directional: RI-HIII/1x10[6]/Adult female heads
lambda gt11/RI/3x10[5]/Testes
--Charles P. Emerson, Jr. or Mary Beth Davis, Biology Dept.,
University of Virginia, Charlottesville, Virginia, 22901, USA
Phone: 215-728-5283 (Emerson); 215-728-5284 (Davis) FAX:
215-728-2412 Email: emerson@castor.rm.fccc.edu or
davis@castor.rm.fccc.edu
Vector/Insertion/Complexity/mRNA source/Titer
lambda gt10/RI/1x10[6]/late pupae/1x10[10]
Blunt-ended cDNA was ligated to EcoRI adaptors, then ligated to
EcoRI digested gt10 lambda arms. We have isolated cDNA clones
corresponding to MHC isoforms that were lengths of 5940 and 5500
bases.
Reference: George, E.L., M.B. Ober, and C.P. Emerson, Jr. (1989)
Functional domains of the Drosophila melanogaster muscle myosin
heavy-chain isoform are encoded by alternatively spliced exons.
Mol. Cell Biol. 9: 2957-2974.
--Bruce Hamilton, Whitehead Institute, 9 Cambridge Center,
Cambridge, MA 02142, USA Phone: 617-258-5174 FAX: 617-258-6505
Email: hamilton@genome.wi.mit.edu
Library name/Vector/Insertion/Complexity/mRNA source
Head M/lambda EXLX/ApaI-SacI/1.1x10[7]/Oregon R adult heads
Head P/lambda EXLX/ApaI-SacI/9x10[6]/Oregon R adult heads
Head 1.2/lambda EXLX/ApaI-SacI/2.7x10[6]/Oregon R adult heads
Head 2.0/lambda EXLX/ApaI-SacI/1.2x10[6]/Oregon R adult heads
Adult/lambda EXLX/ApaI-SacI/>1x10[6]/Oregon R adults
0-24 mojo/lambda EXLX/ApaI-SacI/3.4x10[6]/Can S, 0-24 hr embryos
All libraries were cloned directionally into the ApaI-SacI sites
of lambda EXLX, as described in ref. 1, with internal restriction
sites protected. Lambda EXLX allows in vivo excision of plasmid
DNA using a CRE/loxP site-specific recombination system. This
vector also allows regulated expression of the insert DNA as a
phage T7 gene 10 N-terminal/cDNA fusion protein, under the
control of a T7 RNA polymerase promoter (1). The Head 1.2
library was prepared from cDNAs that were size-selected for
molecules 1.2 kb or larger by fractionation through an agarose
gel. Head 2.0 contains cDNAs that are 2 kb or larger. The cDNA
for the Adult library was not size-fractionated.
The Adult and mojo libraries were published in ref. 1. The Head
M and Head P libraries are unpublished, but I have asked people
who use them to refer to ref. 1, since they were constructed in
the same way and in the same vector. The two size-selected
libraries, Head 1.2 and Head 2.0 were published in ref. 2, which
also describes a rapid screening procedure that is very
straightforward.
References:
1. Palazzolo et al (1990) Gene 88, 25-36.
2. Hamilton et al (1991) Nucl. Acids Res. 19, 1951-1952
--Tom Kornberg, Department of Biochemistry, University of
California, San Francisco, CA 94143 USA Phone: 415-476-8821
FAX: 415-476-3892 Email: tomk@ucsf.cgl.edu
Our cDNA libraries were prepared from RNA isolated from Oregon R
animals, with the cDNA sequences inserted into the EcoRI site of
lambda gt10. Libraries will be shipped by Federal Express.
Requests should be accompanied by an appropriate Federal Express
Authorization Number.
Stage/Library designation/Complexity
0-3 hr embryo/D/300,000
3-12 hr embryo/E/500,000
12-24 hr embryo/F/300,000
1st and 2nd instar/G/200,000
early 3rd instar/H/300,000
late 3rd instar/I/300,000
early pupal/P/300,000
late pupal /Q/300,000
adult male/R/300,000
adult female/S/300,000
Reference: Poole, S., Kauvar, L.M., Drees, B., and Kornberg, T.
(1985) The engrailed locus of Drosophila: Structural analysis of
an embryonic transcript. Cell 40: 37-43.
--John Tamkun, Department of Biology, University of California,
Santa Cruz, CA 95064, USA Phone: 408-459-3179 FAX: 408-459-3139
Vector/Insertion/Complexity/mRNA source
lambda gt11/EcoRI/>6x10[5]/iso-1, 0-24 hr embryos
The iso-1 strain, constructed by Jim Kennison, is isogenic for
all four chromosomes. Genomic libraries from this strain are
also available.
Reference: Tamkun et al. (1986), Cell 46: 271-282.
--Pat Hurban and Carl S. Thummel, Dept. of Human Genetics, 5200
Eccles Institute, Bldg. 533, University of Utah, Salt Lake City,
Utah, 84112 USA Phone: 801-581-2937 FAX: 801-581-5374
Email: cthummel@hmbgmail.med.utah.edu
Vector/Insertion/Complexity/mRNA source
lambda ZAPII/RI-XhoI/2x10[7]/larval tissues cultured in vitro
with cycloheximide + ecdysone
lambda ZAPII/RI-XhoI/3x10[6]/0-24 hr embryos
lambda ZAPII/RI/3x10[5]/0-24 hr embryos
lambda ZAPII/RI-XhoI/2x10[6]/mid-late third instar larvae
lambda ZAPII/RI/2x10[6]/mid-late third instar larvae
lambda ZAPII/RI-XhoI/2x10[5]/0-15 hr pupae
lambda ZAPII/RI/2x10[6]/0-15 hr pupae
All RNA was isolated from Canton S animals. Two cDNA libraries
were constructed from each of three stages: embryonic, late
larval, and early pupal.
One set of libraries was primed from the 3' end using an
XhoI-oligo dT primer adapter. The cDNAs were directionally
inserted between the RI-XhoI sites of lambda ZAPII, such that
XhoI is at the 3' end of the insert and RI is at the 5' end.
Most of these cDNAs should contain 3' end sequences. The other
libraries were synthesized using random primers and the cDNAs
were inserted into the RI site of lambda ZAPII. These libraries
should have a better representation of 5' ends. Although the
synthesis of these libraries went smoothly, none have yet been
tested. We would thus like feedback on the results of any
screens. The titers are all approximately 10[10] pfu/ml. Please
send a Federal Express number to facilitate shipment.
--Peter Tolias, Public Health Research Institute, 455 First Ave.,
New York, New York, 10016 USA Phone: 212-578-0815 FAX:
212-578-0804 Email: tolias@phri.nyu.edu
Vector/Insertion/Complexity/mRNA source
lambda gt22A/SalI-NotI/5x10[5]/Canton S ovaries, stages 1-14
The available amplified aliquots of the Tolias ovarian gt22A directional
cDNA library were titred at 3 x 10(8) pfu/ml (99% inserts) before freezing.
The original complexity of this sample was 500,000 independent clones
(99.7% inserts). The 5' end has unique sites for EcoRI and SalI
(GAATTCGTCGACCCACGCGTCCG), the 3' end has a unique NotI site. Use a fresh
Y1090 O/N grown in LB amp (50 ug/ml), 0.2% maltose and 10 mM MgSO4 as
recommended by most protocols. If you want to screen this library by PCR,
I suggest that you use a small fraction of this aliqout to reamplify and
use only reamplified samples for PCR.
This library has been widely distributed in the USA, Canada and
Europe. To conserve the remaining aliquots, please check oogenesis labs in
your area first before requesting it. If it is not available, please send
us a Federal Express number to facilitate shipment. When you receive the
library, divide it into 50 ul aliquots in siliconized microfuge tubes, add
one drop of chloroform, store one of the aliqouts at 4 deg C and freeze the
rest at -70 deg C. When a frozen aliquot is required, thaw, use and store
at 4 deg C but do not freeze again.
Reference:
Stroumbakis, N.D., Li, Z. and Tolias, P.P. (1994). RNA- and
single-stranded DNA-binding (SSB) proteins expressed during Drosophila
melanogaster oogenesis: a homolog of bacterial and eukaryotic
mitochondrial SSBs. Gene in press.
--Kai Zinn, Division of Biology, 216-76, Caltech, Pasadena, CA
91125, USA Phone: 818-356-8352 FAX: 818-449-0679 Email:
kai@seqvax.caltech.edu
Vector/Insertion/Complexity/mRNA source
lambda gt11/EcoRI/1.2x10[6]/Oregon R, 9-12 hr embryos
The complexity is an underestimate for larger cDNAs, since it was
>5X size-selected for cDNAs larger than 1.8 kb. The complexity
could thus be as high as 6x10[6] for these larger inserts.
GENOMIC LIBRARIES
--Winifred W. Doane, Department of Zoology, Arizona State
University, Tempe, Arizona 85287-1501 USA Phone: 602-965-3571
FAX: 602-965-2012 Email: icwwd@asuacad
Vector/Insertion/Complexity/DNA source
pWE15/BamHI/4x10[4]-1x10[6]/Amy[1,6] mapP[12] strain of D.
melanogaster
This cosmid vector contains a T3 and T7 promoter on either side
of the insertion site, to facilitate the preparation of
end-specific probes for chromosomal walking.
Reference: Thompson, D.B., and Doane, W.W. (1989) A composite
restriction map of the region surrounding the Amylase locus in
Drosophila melanogaster. Isozyme Bull. 22: 61-62.
--Ron Blackman, Department of Cell and Structural Biology, 505 S.
Goodwin Ave., Univ. of Illinois, Urbana, Illinois 61801 USA
Phone: 217-333-4459 FAX: 217-244-1648 Email:
Ron_Blackman@qms1.life.uiuc.edu
Vector/Insertion/Complexity/DNA source
lambda EMBL3/BamHI/1x10[6]/Adult Drosophila virilis
lambda EMBL3/BamHI/1x10[6]/Embryonic D. melanogaster, see below
Both libraries were prepared by MboI partial digestion of the DNA
and insertion into the BamHI site of lambda EMBL3. The inserts
can be excised by digestion with SalI. Titer is approximately
5x10[9] pfu/ml. The D. melanogaster genomic library is made from
animals that are isochromosomal for chromosome 2, dp cn bw. The
same strain was used by Nick Brown for his cDNA libraries.
--Howard Lipshitz, Division of Biology, 156-29, California
Institute of Technology, Pasadena, CA 91125, USA Phone:
818-356-6446 FAX: 818-564-8709 Email:
lipshitzh@starbase1.caltech.edu
Vector/Insertion/Complexity/DNA source
Charon 4/EcoRI/6x10[5]/Canton S embryos
This is the original Drosophila genomic library from the Maniatis
lab. It has been amplified several times but is still useful for
most purposes.
Reference: Maniatis et al., The isolation of structural genes
from libraries of eucaryotic DNA. Cell 15: 687-701.
--Richard W. Padgett, Waksman Institute, Rutgers University,
Piscataway, NJ 08855, USA Phone: 908-932-0251 FAX: 908-932-5735
Email: padgett@mbcl.rutgers.edu
Vector/Insertion/Complexity/DNA source/Titer
lambda DASH II/Sau 3A/5x10[5]/dp cn cl bw/1x10[8]
lambda DASH II/Sau 3A/5x10[5]/st e/1x10[8]
Libraries were constructed from adult DNA from dp cn cl bw and st
e strains. The dp cn cl bw strain is the same one used by N.
Brown in constructing his cDNA libraries. The st e strain is the
same one used by Wieschaus, Nusslein-Volhard and co-workers in
their screens for pattern mutants. Libraries will be sent if the
requester provides a Federal Express number.
Reference: Finelli, A.L., C. A. Bossie, T. Xie and R. W. Padgett
(1994). Antimorphic Alleles of the Drosophila tolloid Gene
Contain Amino Acid Substitutions in the Protease Domain,
Development, in press.
--John Tamkun, Department of Biology, University of California,
Santa Cruz, CA 95064, USA Phone: 408-459-3179 FAX: 408-459-3139
Vector/Insertion/Complexity/DNA source
lambda EMBL3/BamHI/>5x10[5]/iso-1; see ref.
lambda EMBL3/BamHI/>5x10[5]/D. virilis
NotBamNot-CoSpeR/BamHI/high/iso-1
The iso-1 strain, constructed by Jim Kennison, is isogenic for
all four chromosomes. Two genomic libraries of iso-1 DNA are
available, one in a lambda and one in a cosmid vector. Both are
in wide use and have been used successfully by many labs. A cDNA
library from iso-1 0-24 hr embryos is also available.
Reference: Tamkun et al. (1984), PNAS 81: 5140-5144.
*** DIN 14
TECHNICAL NOTES
INJECTING UN-DECHORIONATED EGGS OF DROSOPHILA MELANOGASTER UNDER
ETHANOL
S. Bartoszewski and J.B. Gibson, Molecular and Population
Genetics Group, Research School of Biological Sciences, The
Australian National University, P.O. Box 475, Canberra City, ACT
2601 Australia, E-mail: bartoszewski@rsbs1.anu.edu.au
In using a standard method of injecting Drosophila eggs we
encountered a serious problem with egg viability. Dechorionated
eggs incubated under oil did not develop, while control,
un-dechorionated eggs hatched normally. A method for injecting
un-dechorionated eggs has been described (Robertson et al., 1988;
Cockburn et al., 1991; K. Matthews, personal communication) which
has the advantage that difficulties with controlling humidity and
preventing desiccation are avoided. On the other hand,
un-dechorionated and non-desiccated eggs accept smaller
quantities of injected solution. As we first thought that an
infection might be responsible for the reduced egg viability we
tried immersing un-dechorionated eggs in ethanol. We found that
we obtained good viability when un-dechorionated eggs were
injected when covered with 100% ethanol instead of oil. As
cytoplasm starts leaking after injecting it is precipitated by
the ethanol, sealing the puncture. The treatment probably also
dehydrates eggs to some extent, so it is possible to inject
similar amounts of DNA as were injected into dechorionated and
desiccated eggs. Another advantage of using ethanol is that post
injection care is much easier. The use of ethanol would not be
appropriate if it might affect the phenotype being investigated,
e.g. ADH activity (Bijlsma-Meeles, 1979).
Below we give a detailed protocol for the technique:
1. With a paintbrush put about 100 eggs into a drop of water on
a coverslip stuck to a slide. Mix with a dissecting needle.
Suck out most of the water with a pipette and a tissue. Wash the
eggs again if too much yeast remains.
2. Place eggs in small groups about 3-4 mm from the end of the
coverslip in tiny drops of water. We usually arrange eggs in 10
groups each containing 5 eggs. Using the corner of a rolled
tissue, suck out most of the water from a group of eggs, so that
the eggs can be moved with a dissecting needle. Arrange the eggs
so that they stick together, at an angle of about 45 degrees to
the edge of the coverslip. Repeat with other groups of eggs.
Using a tissue suck out remnants of water and discard the
remaining embryos.
3. Arrange the slide on the microscope stage. Gently, drop
ethanol onto the coverslip. Don't add too much ethanol, because
if it seeps over the coverslip you have to dry the slide and the
coverslip and mount them again. It is better to add more ethanol
as it evaporates. Adjust a needle loaded with DNA so that it is
close to the embryos. Under pressure adjust the needle so that
it just pierces the tip of one of the eggs. Move the needle with
the micro-manipulator horizontally in order to break the tip of
the needle. This procedure gives a very fine broken end to the
needle. The needle we use is more sharply tapering than that
used for dechorionated eggs, but a fine tip is essential. Start
injecting slightly away from the tip of the egg, which is much
harder than the rest of the chorion. Bending the eggs to one
side helps to place the tip of the needle in the germ cytoplasm.
4. After injecting all of the eggs, suck out the ethanol and
under a dissecting microscope destroy any eggs that are too old.
5. Put the coverslip with the embryos into a vial of a fly food.
The coverslip is pushed into the food so that the eggs are in
close proximity to the food surface but not in contact with it.
A few drops of water are added to the cotton plug to keep the
vial humid. The vial does not require any attention until adult
flies start to eclose.
This method gives very good viability - in a recent experiment,
505 eggs were injected and 136 adult flies were obtained. This
is similar to the standard method using dechorionated eggs, but
the injecting and post-injection care takes us about half of the
time required by the standard method.
References: Bijlsma-Meeles, E. 1979, Heredity 42, 79-89;
Cockburn, A.F., Meier, H. and Benedict, M.Q. 1991, DIS 70, 240;
Robertson, H.M., Preston, C.R., Phillis, R.W., Johnson-Schlitz,
D.M., Benz, W.K. and Engels, W.R. 1988, Genetics 118, 461-470.
*** DIN 14
DROSOPHILA INFORMATION NEWSLETTER
Volume 15, July 1994
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 15
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 15
DIN Vol. 15 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Mid-America Stock Center news (Bowling Green)
>Bloomington Stock Center news
>REQUESTS FOR MATERIALS
>Insectavoxes
>MATERIALS AVAILABLE
>Stocks from the Kafatos lab
*** DIN 15
ANNOUNCEMENTS
MID-AMERICA STOCK CENTER NEWS (BOWLING GREEN)
182 new stocks have been added to the collection. The
update of our stock list that we provided to FlyBase this spring
includes these new stocks. For further information, contact Ron
Woodruff or Phyllis Oster, Dept. of Biological Sciences, Bowling
Green State University, Bowling Green, OH 43403. 419-372-2631,
demlano@opie.bgsu.edu.
*** DIN 15
BLOOMINGTON STOCK CENTER NEWS
* myc-tagged FRT stocks: Some people are having problems
getting good staining of myc-tagged clones with the FRT system of
Xu and Rubin (Development 117:1223). According to Gerry Rubin,
the quality of the individual batch of antibody is a critical
factor. He says that the Artavanis-Tsakonas lab, and others,
have generated batches of antibody that give reliably good
results by growing subclones of the monoclonal line (Myc
1-9E10.2) and selecting one that provides good staining.
* Voice-mail is currently unavailable at 812-855-5783.
Please place your stock requests by e-mail to
MATTHEWK@INDIANA.EDU, by FAX to 812-855-2577, or phone 812-855-
5782.
*** DIN 15
REQUESTS FOR MATERIALS
INSECTAVOX
Scott P. McRobert, Dept. of Biology, St. Joseph's University,
Philadelphia, PA 19131. 215-660-1833, smcrober@sju.edu.
Does anyone still build INSECTAVOXes for fun and profit? I
have the box, but I need someone who can install the "guts".
*** DIN 15
MATERIALS AVAILABLE
KAFATOS FLY STOCKS: TERMINATION NOTICE
OK, here is latest from Lorraine Lukas, grand Poobah of the
fly facility:
Approximately half of the Kafatos stocks are past due and
will be autoclaved on Friday, July 8. Flies that will be
maintained until July 31 are described in recent papers authored
by F.C. Kafatos and Shea, Mariani, Orr, Tolias or Fenerjian.
Just as a reminder, select female sterile, amplification
mutants and chorion promoter-lacz transgenics will be maintained
in Heidelburg. Some authors, particularly those still working in
flies, can be contacted directly for stocks. And of course, as
the majority of stocks terminated are transgenic flies, these
lines can be remade by injecting particular constructs, which the
lab in Heidelburg maintains as DNA. So last call, and I will do
my best to fill orders.
Requests should be directed to Dr. Len Dobens (phone
617-495-3292; FAX 617-495-4312; E-mail
dobens@biosun.harvard.edu).
*** DIN 15
DROSOPHILA INFORMATION NEWSLETTER
Volume 16, October 1994
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 16
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 16
DIN Vol. 16 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>New Stock Center at Indore, India
>Bloomington Stock Center news
>Training opportunities at Univ. of Hawaii
>REQUESTS FOR MATERIALS
>Materials in 99C1-E1
>Deficiencies and P{w[+]} lines
>D. simulans with w[+]-marked P inserts
>MATERIALS AVAILABLE
>Chovnick stocks
>TECHNICAL NOTES
>An improved devitellinization technique for x-gal staining
*** DIN 16
ANNOUNCEMENTS
NEW STOCK CENTER AT INDORE, INDIA
A new Drosophila Stock Center has been established at Devi
Ahilya Vishwavidyalaya, Indore, India; it emphasizes the
collection of P insertion, enhancer trap, and other mutant lines.
The center is funded by the Indian government's Department of
Biotechnology, and is run by Pradip Sinha. Dr. Sinha invites all
Drosophila workers to contribute P insertion and other mutant
stocks to the collection. The center can be reached by mail at
School of Life Sciences, Devi Ahilya Vishwavidyalaya, Vigyan
Bhavan, Khandwa Road, Indore-452001, India, or by FAX at 91-731-
473063 (e-mail is not yet available). The Indian Stock Center
stock list will be added to FlyBase as soon as a computerized
version is available.
*** DIN 16
BLOOMINGTON STOCK CENTER NEWS
* We will be away for a FlyBase meeting (plus some vacation)
October 6 through October 17. Requests received by 11AM on
Wednesday, October 5, will be shipped October 10. Requests
received between 11AM Oct. 5 and 11AM Oct. 20 will be shipped
October 24.
* Funding for the stock center has been renewed for the next
5 years, effective September 15, 1994. The collection is now
jointly supported by NSF (Biological Instrumentation and
Resources) and NIH (the National Center for Research Resources,
the National Institute of General Medical Sciences, and the
National Eye Institute). The program officers with
responsibility for the stock center award are Dr. Machi Dilworth
at NSF (mdilwort@nsf.gov) and Dr. Elaine Young at NIH
(elainey@ep.ncrr.nih.gov). Thanks to everyone who helped bring
this about.
Our current funding agreement requires that we institute a
cost-recovery program. We will finalize the plans for this
program and contact each user group with complete details latter
this fall.
* The stocks search function on FlyBase has been changed to
search all three melanogaster center lists at once. A stock
center code precedes each stock number (B for Bloomington, M for
Mid-America, and U for Umea) and the center's name and an e-mail
address for ordering stocks is included as the last line of each
stock record. Please order stocks from the correct center.
* The Bloomington stock list on FlyBase is updated whenever
new stocks become available. If a stock does not appear on our
list we do not have it.
*** DIN 16
TRAINING OPPORTUNITIES AT UNIVERSITY OF HAWAII
Graduate Research Assistantships (Ph.D. or M.S.). The
University of Hawaii announces the availability of graduate
assistantships in Ecology, Evolution & Conservation Biology
(EECB). Students can study any aspect of ecology, evolution
and/or conservation in Hawaii or the Pacific. Much of the
Hawaiian biota consists of species swarms which have arisen from
single ancestors, and, with the islands arranged in chronological
order, provide an unusual opportunity for examining micro-
evolutionary events. In addition, the high local endemism, and
endangered or threatened status of much of the biota, allows
investigation of critical conservation issues. For readers of
this newsletter, we draw particular attention to students
interested in pursuing the developmental and/or evolutionary
genetics of the Hawaiian Drosophila. Such individuals might wish
to contact Dr. Terrence W. Lyttle for further information about
such research opportunities (tlyttle@uhunix.uhcc.hawaii.edu).
Deadline for receipt of all application materials is
February 1, 1995. Assistantships will commence in August 1995.
For application information, contact Kenneth Kaneshiro (Chair) or
Rosemary Gillespie (Associate Chair), Center for Conservation
Research and Training, University of Hawaii, 3050 Maile Hawaii,
Gilmore 409, Honolulu, HI 96822. (808)956-8884,
gillespi@uhuniv.uhcc.hawaii.edu.
*** DIN 16
REQUESTS FOR MATERIALS
MATERIALS in 99C1-E1
David Bilder, Dept. of Developmental Biology, Stanford Univ.
School of Medicine, Stanford, CA 94305-5427, USA. (415)497-2057,
bilder@cmgm.stanford.edu.
I would appreciate hearing about genetic and molecular
information for working in the 99C1-E1 region: P insertions,
lethal complementation groups, chromosome aberrations, chromosome
walks etc. Thank you.
*** DIN 16
DEFICIENCIES AND P{w[+]} LINES
Joan E. Wilson, Dept. of Biological Sciences, Gilbert Building,
Stanford University, Stanford CA 94305-5020. 415-725-8778,
fax/9688, wilsonje@leland.stanford.edu.
Looking for deficiencies in 29C-D, 30D-31B, 44C-46C, 48, 91,
92D-93C. Also any P{w[+]} inserts in or around 29-31 or 91-93.
*** DIN 16
P{w[+]} SIMULANS STRAINS
Dominique Joly, CNRS, Lab. Populations, Genetique et Evolution
91198 Gif sur Yvette Cedex, France. joly@sunbge.bge.cnrs-gif.fr,
Fax: 33 1 69 82 37 34.
I am studying the genetic basis of sperm length in
Drosophila. For that purpose, I would be very interested in any
D. simulans strains carrying a P-white[+] element. I am to your
disposal for any further indications on the experiments that I
would like to realize with those strains. Thanks in advance for
your help.
*** DIN 16
MATERIALS AVAILABLE
Arthur Chovnick, Dept. of Molecular & Cell Biology, U. of
Connecticut, Storrs, CT 06269-2131, USA.
chounick@uconnvm.uconn.edu.
The Chovnick laboratory will not be able to continue to
maintain and provide cultures of rosy region stocks beyond
January 1, 1995. We will honor requests for these stocks until
then.
This collection includes rosy wildtype isoalleles with known
sequence differences as well as mutations induced on the known
isoalleles. Mutant sites cover the entire gene from 5' promoter
to the 3' poly T site, and include Ambers, Opals, Frameshifts,
electromorphs, transitions, transversions, deletions,
duplications and transposable element insertions. They include
complimenters, non-complimenters, leaky mutants, nulls and a
tissue specific overproducer site located in the large 5' intron,
as well as 5' and 3' splice site mutants. The available rosy
stocks include the mutants summarized in Lindsley and Zimm, pages
606 through 614.
Also, we will be discarding stocks carrying mutations in
genes surrounding rosy, and located in 87C, 87D, 87E as well as a
set of overlapping deficiencies in this area. See Lindsley and
Zimm, pages 399 through 402 and page 873.
*** DIN 16
TECHNICAL NOTES
AN IMPROVED DEVITELLINIZATION TECHNIQUE WITH A HIGH YIELD OF
X-GAL STAINED EMBRYOS
A. Singh and M. Kango, Drosophila Stock Center, School of Life
Sciences, Khandwa Road Campus, DAVV, INDORE-452001 (M.P) INDIA.
indra@cat.ernet.in.
X-gal staining (5-Bromo-4-chloro-3-indolyl-beta-D-
galactopyranoside) is frequently employed to study the
spatio-temporal expression of Drosophila genes. These include
enhancer trap studies that involve the insertion of P-lacZ
transposons in the vicinity of desired genes (1) and studies
involving fusion of the lacZ gene to promoters of developmentally
expressed genes (2). X-gal staining is the most popular and
convenient method for studying the developmental expression of a
lacZ reporter gene (2,3). Devitellinization of embryos, however,
is not practiced during X-gal staining since hand peeling of the
membrane is time consuming and cumbersome while chemical
devitellinization (6) results in diffusion of the stain. Lack of
a technique for fast and effective devitellinization of X-gal
stained embryos limits the scope of this technique in the study
of lacZ expression in embryos.
We present here an adaptation of the chemical
devitellinization technique (6) which meets these requirements.
The protocol involves standard X-gal staining that includes
dechorionation of the embryos in bleach (5% Na hypochlorite) and
subsequent treatments with 0.7% NaCl and 1% Triton X-100 for 5
min each. Embryos are then fixed in equal volumes of 3.7%
formaldehyde in citric phosphate buffer, pH 7.6 (4), and heptane
for 15 min. The solution is then drained and the embryos are
gently dried to allow traces of heptane to evaporate. This is
followed by a rinse in citric phosphate buffer (4) and overnight
incubation at 30[o]C in incubation buffer (4) with an increased
concentration of Triton X-100 (0.5%) as compared to the
usual(0.02%) and a saturating amount (4) of X-gal. Stained
embryos are then fixed again with 3.7% formaldehyde, 50 mM EGTA
and an equal volume of heptane for 15 min. Fixed embryos are
flushed with heptane and after adding 1 ml of 5% TCA
(Tricarboxylic acid) stained embryos were shaken for 2 min and
then allowed to stand for 5 min. The solution is then removed
and the embryos are flushed with methanol and shaken vigorously;
the devitellinized embryos will sink down. The duration of this
exercise must not last longer than 3-4 min. The solution is then
replaced with a mixture of fresh incubation buffer and glycerol
(1:1). The embryos will first shrink and then recover their
normal shape in 1-2 hrs. The devitellinized X-gal stained
embryos are then mounted in a glycero gelatin mountant (4). The
time of exposure to methanol should be optimum as prolonged
exposure of the embryos to methanol results in flaky appearance
of the stain possibly due to precipitation of the proteins. In
contrast, shorter periods of exposure give poor yields of
devitellinized embryos. Use of a higher concentration of Triton
X-100 during staining appeared to be important for retaining the
X-gal staining of the devitellinized embryos. This technique
overcomes the limitations of the handpeeling technique and also
prevents the loss of resolution that results from chemical
devitellinization methods due to precipitation of the proteins.
This technique provides improved resolution of the X-gal stained
embryonic cell types.
References:
1. E. Bier et al. (1989) Genes and Dev. 3: 1273- 1287.
2. DiNardo, S. et al. (1988) Nature 332: 604-609.
3. O'Kane, C.J. and Gehring, W.J. (1987) Proc. Natl. Acad. Sci.
U.S.A. 84, 9123- 9127.
4. Ghysen, A. and O'Kane, C. (1989) Development 105: 35-52.
5. Ashburner, M. (1985) : Drosophila : A laboratory manual. Cold
Spring Harbor Laboratory Press.
6. Mitchison, T.J. and Sedat, J. (1983) Dev. Biol. 99: 261-264
*** DIN 16
DROSOPHILA INFORMATION NEWSLETTER
Volume 17, January 1995
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 17
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 17
DIN Vol. 17 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Drosophila Conference dates and places
>Bloomington Stock Center news
>Amazonian biodiversity Institute
>Demerec returns to print
>REQUESTS FOR MATERIALS
>Genetic materials in 51B-C
>Structural data on nervous system development on WWW
>Atlas of an Insect Brain
>Reprints/preprints on development, genetics & evolution
*** DIN 17
ANNOUNCEMENTS
DROSOPHILA CONFERENCE
The 1995 Drosophila Conference will be held in Atlanta,
Georgia, April 5-9. Allan Spradling is the organizer.
The 1996 meeting will be held in San Diego, California,
April 27-May 1. Jim Posakony will be the organizer.
*** DIN 17
BLOOMINGTON STOCK CENTER NEWS
* Beginning January 1, 1995, the weekly stock request
deadline will be 5:00 PM on Wednesdays. All requests that
include our stock numbers and your Bloomington User Number and
are in by the deadline will be shipped to you the following
Monday.
* The Bloomington Stock Center now has a cost-recovery
program. Minimal users of the stock center are not required to
contribute to the center, but all users must be registered with
the center and provide their Bloomington User Number (BUN) when
requesting stocks. Send e-mail to matthewk@indiana.edu for more
information on this program.
*** DIN 17
POSITIONS AVAILABLE AT INSTITUTE OF ECOLOGICAL GENETICS
This is to inform you of the existence of a brand new
Institute of Ecological Genetics to study Amazonian biodiversity.
For further information write to:
Dr. Hugo Hoenigsberg
Instituto de Genetica-Ecologica y Biodiversidad Amazonica
Cra.4 No.71-69
Bogota D.C.COLOMBIA.
FAX: 612 7369
You can send your C.V. to our personal address above. We are
considering applications to fill posts as research scientific
staff members. Evolutionary biologists, geneticists, ecologists,
systematist, botanists, zoologists, mathematicians and other
Ph.D. individuals interested in neo-tropical biological research
with at least 10 years of research experience preferably, but not
exclusively, in the tropics, and about 10 published scientific
papers will be considered. This new Institute will study
Amazonian biodiversity. Although its main purpose is research it
will by inclination help, not only to preserve the Amazonian
biodiversity, but also to disseminate the gospel of international
management of the most wonderful world natural reserve for which
it is worth to dedicate one's life. There will also be graduate
degrees to be dealt with. For academic life within the
Institute, please contact the Rector of the Amazonian University
as follows:
Dr. Ernesto Fajardo
Universidad de la Amazonia
Florencia, Caqueta
Colombia.
FAX: (988 35) 8231
Florencia is the capital of the State of Caqueta, and Caqueta is
one of the three Amazonian States of Colombia. We will be
working closely with Peruvian and Brazilian scientists interested
in Amazonian biodiversity. Our Central offices and research labs
will be in Florencia's surroundings.
*** DIN 17
DEMEREC'S BIOLOGY OF DROSOPHILA
Cold Spring Harbor Laboratory Press has published a
facsimile edition of Demerec's classic on BIOLOGY OF DROSOPHILA.
It was first published by John Wiley and Sons in 1950. Until its
appearance, no central, synthesized source of biological data on
Drosophila melanogaster was available, despite the fly's
importance to science for three decades. Ten years in the
making, it was an immediate success and remained in print for two
decades. However, original copies are now very hard to find.
CONTENTS
*Normal Spermatogenesis in Drosophila (K.W. Cooper)
*The Early Embryology of D. melanogaster (B.P. Sonnenblick)
*Histogenesis, Organogenesis, and Differentiation in the Embryo
of D. melanogaster Meigen (D.F. Poulson)
*The Postembryonic Development of Drosophila (D. Bodenstein)
*External Morphology of the Adult (G.F. Ferris)
*The Internal Anatomy and Histology of the Imago of D.
melanogaster (A. Miller)
*Collection and Laboratory Culture (W.P. Spencer)
632 pp., illus., indexes, ISBN 09-87969-441-6; Cloth $39
To place an order, contact Cold Spring Harbor Laboratory Press at
cshpress@cshl.org, or phone 1-800-843-4388, or fax them at
516-349-1946.
*** DIN 17
REQUESTS FOR MATERIALS
GENETIC MATERIALS IN 51B-C
Michele Crozatier, Centre de Biologie du Developpement, Batiment
4R3, 118, route de Narbonne, 31062 Toulouse, France. Tel: (33)
61.55.82.87, Fax: (33) 61.55.65.07, Email: seroude@cict.fr.
I am looking for deficiencies, P insertions or chromosome
aberrations in 51B6-C3. Thanks in advance for your help.
*** DIN 17
CALL FOR STRUCTURAL DATA ON NERVOUS SYSTEM DEVELOPMENT
Karl-Friedrich Fischbach, Institut fur Biologie III, Schanzlestr.
1, 79104 Freiburg i. Brsg., Germany.
kff@sun1.ruf.uni-freiburg.de; 0761-203-2730, Fax: 0761-203-2745.
Many Drosophila labs have started or are planning to provide
useful information in www. Without well organized linking knots,
this information is somewhat chaotically distributed and not so
easy to access. Therefore, we plan to build such a knot with
regard to nervous system development, first of all for our own
use, but - due to the nature of www - this should be usable by
the whole Drosophila community.
We shall enter in 1995 as much of our own data as possible
(some copyright problems have to be solved and conflict with
conventional publishing to be avoided). Our emphasis will be on
the optic lobe and its larval and pupal development. These data
will be crosslinked to the structural data given free by your
lab. Thus a decentralised international dataweb about the
development of the fly's nervous system will evolve. This
undertaking differs from, but is not in conflict with, the
Drosophila Brain Database just launched by Nick Strausfeld and
Kim Kaiser; it will rather heavily rely on many crosslinks to
this database. Entries in the Tucson-Glasgow Drosophila Brain
Database will be carefully checked by an oversight group, while
we shall simply list www-links under appropriate headings. In
order to minimise electronic traffic on our local computer net,
and in order to maximise speed for your own data retrieval, we
would welcome, if you download those links to your own system.
If you want to participate, E-mail your www-homepage and/or any
comment to kff@sun1.ruf.uni-freiburg.de. Our www-homepage is:
http://deep-thought.biologie.uni-freiburg.de/data/kff.html
*** DIN 17
ATLAS OF AN INSECT BRAIN
Katsuo Furukubo-Tokunaga, Zoological Institute, Univ. Basel,
Rheinsprung 9, CH-4051 Basel, Switzerland. E-mail:
tokunagak@ubaclu.unibas.ch.
Looking for one or two copies of the brain anatomy book
ATLAS OF AN INSECT BRAIN (N.J. Strausfeld, Springer-Verlag) for
educational purpose. If you have this book only to fill your
book shelf, please contact me before you start to think about
cleaning up the space. Thank you.
*** DIN 17
REPRINTS/PREPRINTS ON DEVELOPMENT, GENETICS & EVOLUTION
Richard Gordon, Department of Radiology, University of Manitoba,
ON104, Health Sciences Centre, 820 Sherbrook Street, Winnipeg,
Manitoba, Canada R3A 1R9. E-mail: gordonr@cc.umanitoba.ca, Fax:
(204) 783-8565.
I am finishing a book about the intersection of three major
fields of biology: Gordon, R. (1995). The Hierarchical Genome
and Differentiation Waves: Novel Unification of Development,
Genetics, and Evolution (Singapore: World Scientific), in prep.
If your work might be relevant to this review, I would
appreciate reprints or preprints (mailed to the address above) as
soon as possible, or an update, if I've been in contact with you
previously. Thanks for your help. Please be sure to send your
e-mail address, in case I have any questions.
If you are curious, condensed accounts are given in:
Gordon, R. & G.W. Brodland (1987). Cell Biophysics 11, 177-238.
Gordon, R. (1993). In: Beysens, D., N. Boccara & G. Forgacs, eds.
Dynamical Phenomena at Interfaces, Surfaces and Membranes.
Commack, N.Y.: NOVA Science Publishers, 99-111.
Gordon, R., N. K. Bjorklund & P. D. Nieuwkoop (1994). Int. Rev.
Cytol. 150, 373-420.
Bjorklund, N. K. & R. Gordon (1994). Computers & Chemistry
18(3), 333-345.
*** DIN 17
DROSOPHILA INFORMATION NEWSLETTER
Volume 18, April 1995
The Drosophila Information Newsletter has been established
with the hope of providing a timely forum for informal
communication among Drosophila workers. The Newsletter will be
published quarterly and distributed electronically, free of
charge. We will try to strike a balance between maximizing the
useful information included and keeping the format short;
priority will be given to genetic and technical information.
Brevity is essential. If a more lengthy communication is felt to
be of value, the material should be summarized and an address
made available for interested individuals to request more
information. Submitted material will be edited for brevity and
arranged into each issue. Research reports, lengthy items that
cannot be effectively summarized, and material that requires
illustration for clarity should be sent directly to Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) for publication in DIS.
Materials appearing in the Newsletter will be reprinted in DIS.
Back issues of DIN are available from FlyBase in the directory
flybase/news or in News/ when accessing FlyBase with Gopher.
Material appearing in the Newsletter may be cited unless
specifically noted otherwise.
Material for publication should be submitted by e-mail.
Figures and photographs cannot be accepted at present. Send
technical notes to Carl Thummel and all other material to Kathy
Matthews. The e-mail format does not allow special characters to
be included in the text. Both superscripts and subscripts have
been enclosed in square brackets; the difference should be
obvious by context. Bold face, italics, underlining, etc. cannot
be retained. Please keep this in mind when preparing
submissions. To maintain the original format when printing DIN,
use Courier 10cpi font on a standard 8.5" x 11" page with 1"
margins.
Drosophila Information Newsletter is a trial effort that
will only succeed if a broad segment of the community
participates. If you have information that would be useful to
your colleagues, please take the time to pass it along.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 18
To add your name to the Newsletter distribution list, send one of
the following E-mail messages from the account at which you wish
to receive DIN.
Via Internet -- To: LISTSERV@IUBVM.UCS.INDIANA.EDU
Subject:
Message: SUB DIS-L Your real name
Via Bitnet -- To: LISTSERV@IUBVM
Subject:
Message: SUB DIS-L Your real name
LISTSERV will extract your user name and node from the
E-mail header and add you to the list. Use your Internet address
if you have one. You will receive confirmation by E-mail if you
have successfully signed on to the list. If you are on the list
and do not wish to receive DIN, or you want to remove a soon-to-
be-defunct address, replace SUB in the above message with UNS.
The SUB command can also be used to correct spelling errors in
your real name; the new entry will simply replace the old as long
as it was sent from the same USERID@NODE address.
*** DIN 18
DIN Vol. 18 TABLE OF CONTENTS
>Introduction to Drosophila Information Newsletter
>How to subscribe to the Newsletter
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>1995 Drosophila Board meeting
>Bloomington Stock Center news
>Position available
>MATERIALS AVAILABLE
>Stocks from Burke Judd
>New mutation affecting eye-antennal disc derivatives
>REQUESTS FOR MATERIALS
>Mutations in 15
>Genetic materials in 58D1-2
>GENETIC NOTES
>Problem FRT stock
>D. simulans 3R inversions
>TECHNIQUES
>Need PRINS protocol for Drosophila
*** DIN 18
ANNOUNCEMENTS
DROSOPHILA BOARD MEETS IN ATLANTA
The North American Drosophila Board will meet at 2:00 PM,
Wednesday, April 5, 1995, in Tower Room 1, Westin Peachtree Plaza
Hotel, Atlanta, GA. If you have concerns you would like brought
before the Board, contact your regional representative.
Mariana Wolfner, 1993 President of the Board, posted the
following explanation of the Board to bionet.drosophila on
December 7, 1994. It is reprinted here for those who missed it
and aren't familiar with the Drosophila Board.
The Drosophila Board meets annually during the Flymeeting to
discuss issues of relevance to the fly community. The Board
is composed of:
- regional representatives who represent *you*.
- the present, immediate past and future meetings
organizers.
- ex officio members representing stock centers, DIS, DIN,
FlyBase.
Between meetings, the Board is polled by its president on
any other issue that may need attention. Board reps serve
three-year terms; the terms are staggered.
With this posting I am listing the main issues that were
discussed at the last Board meeting. Please contact your
regional rep if you would like further details, or if you
have comments or issues that you want brought up at future
Board meetings.
The current regional reps are:
Northeast: Welcome Bender
Mid-Atlantic: Margarete Heck
Great Lakes: Helen Salz
Midwest: Bill Engels
Heartland: Juan Botas
California: John Tower
Northwest: Susan Parkhurst
Canada: Tom Grigliatti
The current Board President is Claire Cronmiller.
Addresses of all these individuals are in FlyBase.
Agenda of last Board meeting:
1. Administrative matters related to financial and
organizational issues.
2. Annual flymeeting format, in general, and related issues
3. Statistics for the current meeting (V. Finnerty,
organizer)
4. Future meetings (meeting locations rotate: east coast -
west coast- central)
The dates, sites and organizers for the next several
meetings are:
1995, Atlanta, April 5-9, A. Spradling
1996, San Diego, April 27-May 1, Jim Posakony
1997, Chicago or New Orleans, dates TBA [~April 16-20],
Organizer TBA
1998, East Coast site TBA, dates TBA, Organizer TBA
1999, Seattle, dates TBA, Barbara Wakimoto and Susan
Parkhurst
If you wish to volunteer to organize one of the meetings,
please contact Claire Cronmiller.
5. Reports on operations, statistics and administration
from:
Larry Sandler Lectureship Committee
Stock Centers
DIN
DIS
FlyBase
*** DIN 18
BLOOMINGTON STOCK CENTER NEWS
* We will be closed the week of April 3. Requests received
between 5:00 PM March 29 and 5:00 PM April 12 will be shipped
April 17.
* The linking of Bloomington stocks to alleles and
aberrations in FlyBase has begun. Use the FlyBase WWW homepage
(http://morgan.harvard.edu/) to make use of this new feature.
Options to follow links to stocks are available through the
CytoSearch and SymbolSearch tools. Approximately 700 alleles and
aberrations in Bloomington stock genotypes are not yet linked to
objects in FlyBase.
* A new version of WAIS has caused some odd problems with
wild-card searching of the Stock Center stock lists on FlyBase.
We hope to solve this problem in the next few weeks, but in the
meantime, to be sure you see all available stocks with alleles of
a given gene, search for both gene-symbol* and gene-symbol[*.
This can be done in one step by including both in the same query,
or separately. For example, if you want to see all stocks with
wg alleles, enter your query as:
wg* wg[*
This will produce a complete list.
*** DIN 18
POSTDOCTORAL POSITION AVAILABLE
A position is available to study Drosophila germline sex
determination, Laboratory of Cellular and Developmental Biology,
NIH. For more information contact Brian Oliver at
oliver@sc2a.unige.ch.
*** DIN 18
MATERIALS AVAILABLE
STOCKS AND CLONES
Burke Judd, NIEHS, P.O.Box 12233, Research Triangle Park, NC
27709-2233, USA. Phone: 919-541-4690, FAX 919-541-7593,
judd_b@niehs.nih.gov.
Some of the following are unique combinations of mutants
that will be discarded soon after I leave the NIEHS, March 31,
1995. If you can use any of them please let me know. After
March 31, contact Jim Mason (mason-j@vaxe.niehs.nih.gov), who
will keep the stocks for another few weeks.
z[v77h] w[+] is from Oregon-R
z[v77h] w[67c23]
w[zm]
sc z[1] w[zm]
z[v77h] w[zm]
y z[a] w[zm]
y w[zl]
z[1] w[zl]
y z[a] w[zl]
z[77h] w[zl]
sc z[1] w[zvl]
In(1)w[m4], y
In(1)w[m4], y sn[3]
In(1)w[m4], spl sn[3]
In(1)w[m4], y z[1]
In(1)w[m4], z[v77h] sn[3]
In(1)w[m4h], z[v77h]
In(1)rst[3]
In(1)rst[3], y z[1]
In(1)rst[3], z[v77h]
Df(1)rst[2], y
Df(1)rst[2], z[1]
Df(1)Su(z)J93, y z[1]/FM7: The distal breakpoint of this
deficiency is 35 to 60 kb proximal to the w locus and extends
through rst and vt but does not include N. Deficiency acts as a
dominant suppressor of z[1] apparently by acting on the w locus
in cis. It also exhibits rst, vt, reduced viability and female
sterility. From deletion mapping against various rst and vt
deficiencies, the suppressor of z[1] element is proximal to
rst-vt. Deficiency occurs at very low frequency as an ectopic
exchange product from females heterozygous for y[2] w[sp-2] and
z[1] w[zm] or z[1] w[zl]. Several strains were recovered from
both types of heterozygotes. Original recombinant chromosomes
contained the w[zm] or w[zl] alleles. These have been replaced
by crossingover with w[+] from Oregon-R or with w[65a25]. All
versions of these derivatives and the parental chromosomes are
available. CaSpeR plasmid clones of part of the region from +100
to +163 (white locus map) are available. A transformed line
carrying approximately 17.5kb extending from +122.5 to + 142 is
available. Johng Lim, who did the transformation, also has a
copy of this line.
z[J91]: This allele occurred spontaneously in z[1] w[65a25] spl
sn[3]. It causes lemon-yellow eye-color in z[J91] w[+] males and
z[J91] w[+]/z[+] w[+] females. It acts only in cis, however,
thus most likely is acting on the w locus.
z-w lethals: One allele of each of 13 lethals located in the
region between the z and w loci will be deposited in the
Mid-America Stock Center at Bowling Green. As many as three
alleles for each locus will be kept here until sometime in April.
The deficiencies generated by ectopic recombination in the region
flanking the w locus that are described in Montgomery et al.,
(1991) Genetics 129: 1085-1098, will be available for a few more
weeks.
echinus locus: We have cloned and sequenced genomic and cDNA
that we believe to be the ec locus. However, a transformed line
carrying the genomic sequences fails to rescue ec mutations, thus
we have not yet published this. Fly strains and clones are
available to anyone who is interested in a collaboration to
complete this analysis. Contact Bibba Goode, Laboratory of
Reproductive Toxicology, NIEHS, P.O. Box 12233, RTP, NC 27709.
*** DIN 18
NEW MUTATION AFFECTING EYE-ANTENNAL DISC DERIVATIVES
Byeong-ryool Jeong, Department of Biology, Box B79, Indiana
Univ., Bloomington, IN 47405, USA. Phone: 812-855-8175,
bjeong@ucs.indiana.edu.
I found a dominant mutation that resides on the third
chromosome in a maintained stock of labial[vd1]. Genetic mapping
indicates that this mutation is between curled and ebony. The
adult phenotype of this mutation includes: irregular facets and
hairs in the eyes (frequent), duplicated or irregular postorbital
bristles (frequent), tufted or mirror-image-duplicated vibrissae
(frequent), very small eyes (rare), duplication of the antennae
(rare), and crooked bristles on top of the head. All of these
defects seem to be derived from the eye-antennal disc, and when I
looked at the eye-antennal disc of the third instar larvae, I
could find morphological defects in some of the discs, such as
humps on the eye or the antennal disc. Expression pattern of
labial seemed to be unaffected. I named this mutation
"Dead[BJ1]" for "Defective eye-antennal disc."
In addition to the above phenotypes, this mutation seemed to
be temperature-sensitive dominant lethal at 25oC, and to have
very low fecundity. I failed to separate the mutation from
lab[vd1], therefore, the genotype of the stock is lab[vd1]
Dead[BJ1]/TM6B, Tb Hu.
This stock will be discarded about the middle of April. If
anyone wants this stock, please contact me at the e-mail address
above.
*** DIN 18
REQUESTS FOR MATERIALS
MUTATIONS IN 15
Jim Bloor, Wellcome/CRC Institute, Tennis Court Road, Cambridge,
CB2 1QR, UK. Tel. 0223 334129, Fax. 0223 334089,
jwb1003@mole.bio.cam.ac.uk.
I am searching for mutations within division 15 of the X
chromosome. I have inflated, rudimentary, bazooka, M(1)15D and
forked alleles. I would like any others, can anybody help?
*** DIN 18
GENETIC MATERIALS IN 58D1-2
Qi Sun, Division of Biology, 216-76, Caltech, Pasadena, CA 91125,
USA. Tel. 818-395-8353, FAX, 818-449-0679,
sunq@starbase1.caltech.edu.
I am looking for deficiencies, P insertions or chromosome
aberrations in 58D1-2 or near that region. Thanks in advance for
your help.
*** DIN 18
GENETIC NOTES
A PROBLEM FRT STOCK
Norbert Perrimon, Dept. of Genetics, HHMI - Harvard Medical
School, 200 Longwood Ave., Boston, MA 02115-6092, USA.
perrimon@rascal.med.harvard.edu.
We recently discovered that the Sco FRT40A chromosome which
some of you may have obtained from our lab to build recombinants
between FRT40A and a specific mutation (m) contains an additional
lethal between the FRT and Sco. When this chromosome is used to
build recombinants between m and the FRT element, some
recombinants will be FRT l m or FRT l rather than the desired FRT
m. If you have used this chromosome you should test the putative
FRT m recombinant lines for the presence of either m or l. Since
Sco is homozygous lethal the presence of the second lethal was
not readily detectable. As far as we know the other FRT lines
which have been recombined with dominant markers are not
associated with a similar problem. We are sorry for any
inconvenience this may cause you.
*** DIN 18
D. SIMULANS 3R INVERSIONS
Jerry Coyne, Dept. Ecology and Evolution, The Univ. of Chicago,
1101 E. 57th St., Chicago, IL 60637, and P. Sniegowski, The
Center for Microbial Ecology, PSSB, Michigan State University,
East Lansing, MI 48824. jcoyne@pondside.uchicago.edu.
We report here a third-chromosome balancer stock of D.
simulans that contains previously undescribed paracentric
inversions. A full description of the isolation of this
chromosome will appear in DIS 75. The normal 3R of D. simulans
differs from that of D. melanogaster by a paracentric inversion
of 9 numbered divisions. Using the D. melanogaster system, the
chromosome order of the normal D. simulans 3R is
61-84F/93F-84F/93F-100. Relative to D. melanogaster, the D.
simulans balancer chromosome has the sequence:
61-81F1/[89E1-93F/84F-84E1/84B1-84E1/84B1-81F1]/89E1-84F/93F-100
(The region in brackets is the region inverted relative to the
normal D. simulans 3R).
This aberration is associated with the dominant mutation
Ubx[m] and Dl lies within the inverted region. Although the
region balanced by this chromosome is rather small, the stock is
useful because it allows one to keep two dominant alleles in
trans condition without selection.
*** DIN 18
TECHNIQUES
NEED PRINS PROTOCOL FOR DROSOPHILA
Elisabeth Hauschteck-Jungen, Zoologisches Institut der
Universitaet, Winterthurerstr. 190, 8057 Zuerich, Switzerland.
Fax: 1 361 31 85; K598315@CZHRZU1A or office28@zool.unizh.ch.
PRINS is a successful technique in human cytology but we did
not succeed to apply it to Drosophila melanogaster mitotic
chromosomes and also not satisfactorily to polytene chromosomes.
Does anybody have a PCR protocol which works on polytene
chromosome? We would be grateful to get some information.
*** DIN 18
DROSOPHILA INFORMATION NEWSLETTER
Volume 19, July 1995
The Drosophila Information Newsletter is going away. The
network newsgroup bionet.drosophila is functioning well and can
carry out the functions of DIN with greater timeliness and less
effort. Volume 20 will be the final edition of DIN. Thank you
to all who contributed to DIN over the past five years.
We encourage readers of DIN to make use of the
bionet.drosophila newsgroup. You can participate in
bionet.drosophila via newsreader software on your local system,
by an e-mail subscription to bionet.drosophila, or through the
archive in FlyBase/News/bionet.drosophila. Message traffic on
bionet.drosophila averaged 2 messages per day from 1/1/95 through
6/28/95. Contact your local computer whiz if you want to access
bionet.drosophila with newsreader software. If you want an e-
mail subscription to bionet.drosophila, send a message to
biosci-server@net.bio.net with the following line in the body of
the message:
subscribe drosophila
The subject line can be blank. Send this message from the
account at which you wish to receive postings to
bionet.drosophila.
To post a message to the group, use your newsreader
software, or send your post as an e-mail message to
dros@net.bio.net. Unlike subscription messages, messages to be
posted must include a subject in the subject line of the message.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 19
DIN Vol. 19 TABLE OF CONTENTS
>Drosophila Information Newsletter RIP
>How to use bionet.drosophila
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Crete 10th-Anniversary Meeting
>6th European Symposium on Drosophila Neurobiology
>Position available
>Stock center news
>MATERIALS AVAILABLE
>Library update - Tolias ovarian gt22A cDNA library
>REQUESTS FOR MATERIALS
>Genetic materials in 8A-C
>EQUIPMENT
>An inexpensive activity monitor suitable for Drosophila
*** DIN 19
ANNOUNCEMENTS
CRETE 10th-ANNIVERSARY MEETING
Spyros Artavanis-Tsakonas, Crete Workshop Organizing Committee,
Boyer Center for Molecular Medicine, Room 236, 295 Congress
Avenue, Yale University School of Medicine, New Haven, CT 06510
USA.
The Crete meeting on the Molecular and Developmental Biology
of Drosophila will be held from July 14th through July 20, 1996.
All subsequent meetings are also scheduled for the middle of
July. Although a formal announcement will be made in the Fall,
applications to attend the meeting are currently being accepted.
This will be the tenth anniversary of the Crete Workshop.
*** DIN 19
6TH EUROPEAN SYMPOSIUM ON DROSOPHILA NEUROBIOLOGY
Stephan Schneuwly
The next European Symposium on Drosophila Neurobiology will
be held on September 15-19, 1996 in Regensburg, Germany.
Regensburg is a beautiful historic bavarian city, which can be
easily reached by car, train and airplane (International Airports
of Munich and Frankfurt). To keep the meeting costs as low as
possible we are planning to communicate mainly through E-mail and
FlyBase. If you would like to be posted on the mailing list, send
a short message to the following mailbox:
sekretariat.schneuwly@biologie.uni-regensburg.de
*** DIN 19
POSITION AVAILABLE
An unusual job is open for applicants. Paul Johnston, Peter
Lawrence's assistant and collaborator of 20 years died in March.
Peter is now looking for someone to fill this post which is
funded by the Medical Research Council to be held in Cambridge,
England at the MRC Laboratory of Molecular Biology. The person
should be well experienced with flies (practical Drosophila
genetics, antibodies and RNA in situs, preparing eggs for
injection, dissecting and mounting adults, etc ). The work would
be to assist Peter in his own experiments and when he
collaborates with others. The style of the lab is old fashioned:
Peter works at the bench and the assistant would be, in the main,
a coauthor on the papers. The most important quality sought is
meticulousness and high standards. Salary would depend on paper
qualifications, such as whether the person has a PhD. A BA
degree or equivalent would be necessary. A work permit might be
obtainable for an ideally qualified person.
Interested? If so please email C.V. and relevant
information to Peter Lawrence at pal@mrc-lmb.cam.ac.uk or write
to him at the MRC Laboratory of Molecular Biology, Hills Rd.,
Cambridge, CB2 2QH, England.
*** DIN 19
STOCK CENTER NEWS - BLOOMINGTON
* We will be closed the week of September 17 (road trip!).
Requests received by 5:00 PM Wednesday, September 13 will be
shipped on Monday, September 18. Requests received between 5:00
PM on the 13th and 5:00 PM on Wednesday, September 27th will be
shipped on Monday, October 2. Mark your calendar.
* We have begun a collection of stocks carrying generally
useful GAL4 and UAS constructs. Stocks that are ready for
release are listed below with the names, pattern information, and
references provided by the donors. These short names will be
replaced by full genotypes when FlyBase curators have assigned
valid construct symbols and insertion identifiers. You may order
these now by stock number. We hope to have additional lines by
the end of the summer. If you have GAL4/UAS stocks of general
interest that you would like to contribute to the collection
please contact Kathy Matthews (matthewk@indiana.edu) or Thom
Kaufman (kaufman@bio.indiana.edu).
GAL4 constructs
1734 1J3 (hairy) [1,4,5]
1747 71B (imaginal discs) [1]
1767 24B/TM3 (embryonic mesoderm) [1]
1774 69B/TM3 (embryonic epiderm, imaginal discs) [1,4]
1782 32B/TM3 (imaginal discs) [1]
1795 30A/CyO (imaginal discs) [1,6]
1799 hs-Gal4[89-2-1]/TM3 (heat shock Gal4)
1803 55B (follicle cells) [3]
1822 31-1 (CNS/PNS)
1824 pGawB (basal expression)
1854 1-76-D (epidermal stripes)
1874 389 (embryonic CNS)
1878 T80 (ubiquitous in 3rd instar imaginal discs) [4]
1947 RG1 (paired) [1,5]
1967 34B [1,6]
1973 e22c (ubiquitous)
2017 ptc-Gal4 [8,4]
2023 hs-sev-Gal4 [9]
UAS constructs
1776 UAS-lacZ[4-1-2] (cytoplasmic beta-gal, insert on 2) [1]
1777 UAS-lacZ[4-2-4B]/TM3 (cytoplasmic beta-gal)
2025 D-Ras2[Val14] (constitutively activated Drosophila Ras2) [3]
2033 deltaD-Raf[F179] (constitutively activated Drosophila raf)
[3]
2074 deltaC-Raf1[ra2] (constitutively activated form of human Raf
1) [3]
2075 wg[tsM7-2-1] [4]
2076 en [5]
References
[1] Brand and Perrimon (1993) Development 118: 401-415
[2] Brand, Manoukian and Perrimon (1994) Methods in Cell Biology,
Vol 44: 635-654
[3] Brand and Perrimon (1994) Genes and Dev. 8: 629-639
[4] Wilder and Perrimon (1995) Development 121: 477-488
[5] Yoffee et al. (1995) Development, in press
[6] Ingham and Fietz (1995) Current Biology 5: 432-440
[7] Staehling-Hampton et al. (1994) Cell Growth and
Differentiation, in press
[8] Speicher et al. (1994) Development 120: 535-544
[9] Ruberte et al. (1995) Cell 80: 889-897
[10] Greig and Akam (1993) Nature 362: 630-632
[11] Hinz et al. (1994) Cell 76: 77-87
*** DIN 19
MATERIALS AVAILABLE
TOLIAS OVARIAN gt22A cDNA LIBRARY
Peter P. Tolias, Public Health Research Institute, 455 First
Ave., New York, NY 10016, USA. Phone: (212) 578-0815 office;
(212) 578-0816 lab; Fax: (212) 578-0804; E-mail:
tolias@phri.nyu.edu.
The following information updates that published in DIN Vol.
9 and DIS 72.
The available amplified aliquots of the Tolias ovarian
gt22A directional cDNA library were titred at 3 x 108 pfu/ml (99%
inserts) before freezing. The original complexity of this sample
was 500,000 independent clones (99.7% inserts). The 5' end has
unique sites for EcoRI and SalI (GAATTCGTCGACCCACGCGTCCG), the 3'
end has a unique NotI site. Use a fresh Y1090 O/N grown in LB amp
(50 ug/ml), 0.2% maltose and 10 mM MgSO4 as recommended by most
protocols. If you want to screen this library by PCR, I suggest
that you use a small fraction of this aliquot to reamplify and
use only reamplified samples for PCR.
This library has been widely distributed in the USA,
Canada and Europe. To conserve the remaining aliquots, please
check oogenesis labs in your area first before requesting it. If
it is not available, please send us a Federal Express number to
facilitate shipment. When you receive the library, divide it
into 50 ul aliquots in siliconized microfuge tubes, add one drop
of chloroform, store one of the aliquots at 4 deg C and freeze
the rest at -70 deg C. When a frozen aliquot is required, thaw,
use and store at 4 deg C but do not freeze again.
This library should be referenced in publications as:
"Stroumbakis, N.D., Li, Z. and Tolias, P.P. (1994). RNA- and
single-stranded DNA-binding (SSB) proteins expressed during
Drosophila melanogaster oogenesis: a homolog of bacterial and
eukaryotic mitochondrial SSBs. Gene 143, 171-177."
*** DIN 19
REQUESTS FOR MATERIALS
GENETIC MATERIALS IN 8A-C
Brenda Lilly, Baylor College of Medicine, One Baylor Plaza,
Houston, TX, 77030, USA. phone (713) 798-3569, FAX (713),
798-5386, lilly@bcm.tmc.edu.
I am looking for deficiencies, P-elements and chromosome
aberrations in the 8A-C region of the X-chromosome. Any
materials or information would be greatly appreciated. Thanks.
*** DIN 19
EQUIPMENT
AN INEXPENSIVE ACTIVITY MONITOR SUITABLE FOR DROSOPHILA
Robert Tyler and *Christopher Driver, Deakin University, Rusden
Campus, 662 Blackburn Rd Clayton 3168 AUSTRALIA.
*email; drierac@deakin.edu.au
INTRODUCTION
A commonly measured activity in Drosophila is locomotory
activity. It is reduced in a large number of mutants. In addition
one of us has used this measurement in investigating changes with
age ( Driver et alia 1986). The genetic dissection of this
activity offers an readily accessible window into the link
between activity and neurological function, particularly for an
activity which changes with age. We have been unable to find a
simple and inexpensive device to measure this and to simplify
further measurements we have built an electronic activity meter.
This meter responds to breaking an IR light beam and records each
break as a separate digit. A novel feature of our design is the
use of four calculators as four separate parallel recorders,
which enabled a substantial reduction in cost. The total cost of
components was under A$70. The device is portable and can be
placed in a controlled temperature cabinet so that activities can
be measured under controlled temperature and lighting conditions.
The use of batteries as power sources isolates the device from
power surges which might give false readings.
CONSTRUCTION
Circuit components were supplied by National Semiconductor.
IR beam. Four Photo-Interrupter pair (electronic catalog
listing ZD1901 or SY-508) were supplied with the emitter and
detector on the one block: these were cut into two at the base to
separate the emitter and detector. These were separately mounted
on either side of four holes on a particle board, which was
sufficiently large to fit four vial (25mm x 75 mm) snugly.
Recording devices: Citizen LC-510N electronic calculators.
Power pack: a battery pack which carries four AA batteries.
The use of rechargeable batteries has been found most convenient
because the drain on the batteries necessitates frequent changes.
Conditioning of the signal from the photo transistor was by
a Schmidt trigger flip flop (CD 4093) which converted
interruptions of currents to pulses. The input and out leads of
each of the four circuits on this chip were connected to the M+
key on the calculators. Inputs from the photo-interrupt were
connected to the terminals labelled CONT A,B,C, and D
respectively. The control voltage input was connected to the +
side of the power pack.
The - side of the battery pack was connected to a push
button switch and then via a 100 K ohm resistor to each
photo-interrupt.An indicator LED was also wired in, connecting
the side of the switch away from the battery to the + side of the
battery pack via a 470 ohm resistor.
The circuitry was then fixed to the same board that the
phot-interrupts were mounted on. Total dimensions: 450mm x80 mm
OPERATION
Vials containing 20 flies were used. The foam top was pushed
down into the tube to give a gap between the foam and the medium
of 150 mm. The tubes were inserted into the holes in the board.
The power from the batteries was switched on, the calculators
switched on and the number 1 entered into each calculator, in
that order. At the end of 5 minutes the <memory return> button
was pressed on each calculator to get an accumulated number. The
vials were changed to another hole and the readings repeated.
This procedure was repeated twice more so that each vial was
measured once in each hole. This alternation permits systematic
differences between recording sites to be evened out. In addition
the flies were restimulated to move. Between readings the
calculators were switched off, and the main power switched off,
in that order.
If there is no event for a long period the calculators will
turn off. This period is about five minutes, so if a calculator
was found to be turned off, the reading was taken as zero.
PROBLEMS IN OPERATION.
The device will measure activity in vials which have medium
in them, provided that the surfaces are clean. If the light beam
is blocked, difficulty will be experienced in operating the
calculators: the keys do not respond. In most cases this problem
could be overcome by repositioning the vials so that the IR beam
is not blocked.
It was also found that after prolonged operation the
calculator failed to respond to the keys, particularly during
the switching off procedure.This appears to be due to the drain
on the batteries. In addition, if the memory is not cleared
after the last use, then extra-ordinarily high readings may be
found after the next measurement. If the switching sequence above
is used so that the device has periods of being off between
readings, these problems can be minimised. However frequent
battery replacement (or recharging) is necessary.
RESULTS AND DISCUSSION.
An individual tube filled with Canton-S flies up to 7 days
old will give a reading of 50-200 counts at 20-25 degrees
celsius, although very inactive mutants such as dunce, and older
flies are considerably less active.
The activity measured is activity after alarm, i.e. an alarm
response. If flies are left undisturbed on a vibration free
surface for an hour or more, then counts measured over the next
20 minutes, without moving the vials, are in the order of 0-2. We
are using this to genetically dissect alarm response and the way
this changes with age. The results of this investigation will be
reported elsewhere.
REFERENCE
Driver, C.J.I.; Wallis, R.; Cosopodiotis, G.; Ettershank, G. Is a
Fat Metabolite the Major Diet Dependent Accelerator of Ageing?
Exp. Gerontol. 14:497-507; 1986.
*** DIN 19
DROSOPHILA INFORMATION NEWSLETTER
Volume 20, October 1995
This is the final (and content-free) issue of Drosophila
Information Newsletter. Thanks to all who contributed to DIN
over the past five years, and apologies to those of you who have
just subscribed.
We encourage all of you to make use of the bionet.drosophila
newsgroup. Announcements from FlyBase, the stock centers, and
meeting organizers appear on bionet.drosophila, along with job
openings and questions and answers about a variety of topics
relevant to researchers and teachers using Drosophila. You can
participate in bionet.drosophila via newsreader software on your
local system, by an e-mail subscription to bionet.drosophila, or
through the archive in FlyBase/News/bionet.drosophila. Contact
your local computer whiz if you want to access bionet.drosophila
with newsreader software. If you want an e-mail subscription to
bionet.drosophila, send a message to biosci-server@net.bio.net
with the following line in the body of the message:
subscribe drosophila
The subject line can be blank. Send this message from the
account at which you wish to receive postings to
bionet.drosophila.
To post a message to the group, use your newsreader
software, or send your post as an e-mail message to
dros@net.bio.net. Unlike subscription messages, messages to be
posted must include a subject in the subject line of the message.
Publication of DIS, Drosophila Information Service, is
independent of DIN and will continue. Contact Jim Thompson
(THOMPSON@AARDVARK.UCS.UOKNOR.EDU) to contribute to or purchase
regular issues of DIS. Contact Bill Gelbart
(GELBART@MORGAN.HARVARD.EDU) to purchase special FlyBase issues
of DIS.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK@INDIANA.EDU
CTHUMMEL@HMBGMAIL.MED.UTAH.EDU MATTHEWK@INDIANA.BITNET
*** DIN 20
DIN Vol. 20 TABLE OF CONTENTS
>Drosophila Information Newsletter RIP
>How to use bionet.drosophila
>DIS is alive and well
>TABLE OF CONTENTS
*** DIN 20